ID: 1169901758

View in Genome Browser
Species Human (GRCh38)
Location 20:10560235-10560257
Sequence CTGTAGACAGGGATGGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169901758_1169901766 -5 Left 1169901758 20:10560235-10560257 CCTGGCCCCATCCCTGTCTACAG No data
Right 1169901766 20:10560253-10560275 TACAGTCCCCTGGCCACACTGGG 0: 1
1: 0
2: 1
3: 13
4: 140
1169901758_1169901771 7 Left 1169901758 20:10560235-10560257 CCTGGCCCCATCCCTGTCTACAG No data
Right 1169901771 20:10560265-10560287 GCCACACTGGGTGTTTCCCTGGG 0: 1
1: 0
2: 1
3: 23
4: 192
1169901758_1169901765 -6 Left 1169901758 20:10560235-10560257 CCTGGCCCCATCCCTGTCTACAG No data
Right 1169901765 20:10560252-10560274 CTACAGTCCCCTGGCCACACTGG 0: 1
1: 0
2: 0
3: 16
4: 171
1169901758_1169901770 6 Left 1169901758 20:10560235-10560257 CCTGGCCCCATCCCTGTCTACAG No data
Right 1169901770 20:10560264-10560286 GGCCACACTGGGTGTTTCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 194
1169901758_1169901773 8 Left 1169901758 20:10560235-10560257 CCTGGCCCCATCCCTGTCTACAG No data
Right 1169901773 20:10560266-10560288 CCACACTGGGTGTTTCCCTGGGG 0: 1
1: 0
2: 0
3: 22
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169901758 Original CRISPR CTGTAGACAGGGATGGGGCC AGG (reversed) Intronic
No off target data available for this crispr