ID: 1169904487

View in Genome Browser
Species Human (GRCh38)
Location 20:10587880-10587902
Sequence TTCTTCTACTAGAAGTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17088
Summary {0: 1, 1: 0, 2: 7, 3: 257, 4: 16823}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169904487_1169904493 24 Left 1169904487 20:10587880-10587902 CCATAAAACTTCTAGTAGAAGAA 0: 1
1: 0
2: 7
3: 257
4: 16823
Right 1169904493 20:10587927-10587949 GGTCCTGACAATGATTTTTTTGG 0: 1
1: 1
2: 18
3: 90
4: 329
1169904487_1169904491 3 Left 1169904487 20:10587880-10587902 CCATAAAACTTCTAGTAGAAGAA 0: 1
1: 0
2: 7
3: 257
4: 16823
Right 1169904491 20:10587906-10587928 GGGAAATGGCTCCTTGACATTGG 0: 1
1: 0
2: 17
3: 78
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169904487 Original CRISPR TTCTTCTACTAGAAGTTTTA TGG (reversed) Intronic
Too many off-targets to display for this crispr