ID: 1169905455

View in Genome Browser
Species Human (GRCh38)
Location 20:10598750-10598772
Sequence CTGGTAAGAAGCCGATTTCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169905453_1169905455 6 Left 1169905453 20:10598721-10598743 CCTTCGCTGCATCAGGAGCACAC 0: 1
1: 0
2: 4
3: 13
4: 99
Right 1169905455 20:10598750-10598772 CTGGTAAGAAGCCGATTTCTTGG 0: 1
1: 0
2: 0
3: 9
4: 99
1169905451_1169905455 24 Left 1169905451 20:10598703-10598725 CCTCAAGAGAGGGATACGCCTTC 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1169905455 20:10598750-10598772 CTGGTAAGAAGCCGATTTCTTGG 0: 1
1: 0
2: 0
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169905455 Original CRISPR CTGGTAAGAAGCCGATTTCT TGG Exonic
902208683 1:14888840-14888862 CTGATCAGAAGCCTATATCTAGG + Intronic
908979757 1:69941503-69941525 GTGGTAAGAAACCAATTTCTGGG + Intronic
914505881 1:148288393-148288415 CTGGGAAGAGGCCGATTTGGCGG + Intergenic
915244870 1:154549488-154549510 CTGGTTAGAAGCCACTTTCCAGG + Exonic
919641014 1:200043250-200043272 CTGCTGAGAAGCGGGTTTCTGGG + Intronic
919840428 1:201605288-201605310 CAGGTAGGAAGCCGGTTGCTAGG - Intergenic
921964439 1:221073301-221073323 CTGGTCAGATGGCCATTTCTGGG - Intergenic
923526387 1:234776015-234776037 CTGATAAGAATCAGATTTCTAGG - Intergenic
924017974 1:239748549-239748571 CTGTGCAGAAGCTGATTTCTAGG + Intronic
1065003719 10:21360960-21360982 CAGGAAAGAAGCAGATTTCTTGG - Intergenic
1067196870 10:44127645-44127667 CTGGTAAAAACCTTATTTCTGGG + Intergenic
1072806705 10:98428082-98428104 CTGTTGAGAAGCAGAGTTCTGGG - Intronic
1076551749 10:131283230-131283252 ATGGAAAGAAGTCGACTTCTTGG - Intronic
1076776379 10:132700187-132700209 CTGGAAAGTAGACGATTCCTGGG + Intronic
1079907201 11:26263478-26263500 CTGGGAAGGAGCAGCTTTCTTGG - Intergenic
1081238234 11:40672177-40672199 CTGGTAAGGGCCAGATTTCTAGG + Intronic
1083493920 11:63033935-63033957 CAGGTAAGAAGCCCTCTTCTAGG - Intergenic
1087183354 11:95160489-95160511 CTGGGAAGGAGCCAAGTTCTAGG - Intergenic
1087540877 11:99517898-99517920 CTGGTAACTAGCATATTTCTTGG + Intronic
1089374588 11:117985759-117985781 CTGGTTAAAAGCCTCTTTCTTGG + Intergenic
1089586569 11:119513293-119513315 CTGGCAAGAACCCCATCTCTGGG - Intergenic
1094039656 12:26109666-26109688 CTGGAAATAAGCCGAGGTCTTGG + Intergenic
1094824494 12:34258917-34258939 CTGGTAAGAAGACAAATGCTGGG + Intergenic
1098332561 12:69369135-69369157 CTGTTAAAAAGCAGTTTTCTTGG - Intronic
1099368883 12:81805382-81805404 CTGGTAAGAAATTGAGTTCTTGG + Intergenic
1101019413 12:100538008-100538030 CTTATAACAAGCAGATTTCTCGG - Intronic
1103371757 12:120424660-120424682 CTTGTAAGATGCAGATTCCTGGG - Intergenic
1104074456 12:125377009-125377031 CTGGTAAAATGCAGATCTCTTGG + Intronic
1109690887 13:65887065-65887087 TTGGTAAGAATCTGATTTTTGGG - Intergenic
1109934192 13:69259663-69259685 CTGGTAACAATCCCACTTCTAGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114385891 14:22254061-22254083 CTGGAAAGAAACCCAGTTCTGGG - Intergenic
1115260080 14:31443003-31443025 CTGTTAAGATGCAGTTTTCTGGG - Intronic
1119566041 14:75630195-75630217 CTGGTAGAAAGCAGATTCCTAGG - Intronic
1119647996 14:76362372-76362394 CAGGTATGAAGCCGGTTGCTAGG - Intronic
1120766580 14:88332959-88332981 GTGGCAAGAAGCAGATTCCTAGG + Intergenic
1120877084 14:89384990-89385012 CTGGTAAGATGCCGACTTAGGGG - Intronic
1122757624 14:103995205-103995227 CTGGTTAGAAGCCATATTCTAGG + Intronic
1124266270 15:28237086-28237108 CTGGTATGGTGACGATTTCTTGG + Exonic
1124311878 15:28633595-28633617 CTGGTATGGTGACGATTTCTTGG - Intergenic
1125036478 15:35130452-35130474 CTGGGAGGAAGCCAATTTCAAGG + Intergenic
1126803292 15:52320154-52320176 CAGGTGAGAAGACGAATTCTGGG - Intronic
1128069319 15:64784354-64784376 CTGGAAAAAAGAAGATTTCTGGG + Intergenic
1132221840 15:100110945-100110967 CTGGTGAGAAGCAGACTTCGTGG - Intronic
1133727510 16:8551152-8551174 CTGGTAAAAACCAGAATTCTAGG - Intergenic
1134848533 16:17461367-17461389 CTGATAAGTGGCCGATCTCTAGG - Intronic
1135938492 16:26800999-26801021 TTGGTAAGTAGCTAATTTCTTGG + Intergenic
1136017301 16:27408898-27408920 CTGGAAAGAACCCAAGTTCTTGG - Intronic
1138050589 16:53773051-53773073 CTGGGAAGCAGCTGATTACTTGG + Intronic
1148603848 17:48913651-48913673 CTTGTAAAAAACAGATTTCTGGG - Intronic
1148956869 17:51361418-51361440 CTGGGAAGAAGCCACTTCCTAGG - Intergenic
1149354483 17:55825991-55826013 CTGGAATGATGCCGATTTCTGGG - Intronic
1161610039 19:5237424-5237446 CTGGGCCGAAGCCGCTTTCTAGG + Intronic
1166485795 19:43210925-43210947 CTGGGAAGATGCCGGTTTCCAGG - Intergenic
1166492954 19:43274877-43274899 CTGGGAAGATGCCGGTTTCCAGG - Intergenic
925635029 2:5934577-5934599 CTGGGAAGATGACAATTTCTGGG + Intergenic
926704203 2:15825362-15825384 CTGGTGGGAAGGAGATTTCTCGG + Intergenic
929583605 2:43100502-43100524 CTGGTAAAATGCAGTTTTCTGGG + Intergenic
929762749 2:44819756-44819778 CTGGGAAGAGGCAGATTTCAAGG + Intergenic
931230392 2:60369608-60369630 ATGGTAAAAAGCCAATTCCTAGG - Intergenic
941644176 2:168022700-168022722 ATAGTAATAAACCGATTTCTGGG + Intronic
942272062 2:174286382-174286404 CTGGTGAGCAGCTGAATTCTAGG + Intergenic
942764207 2:179434597-179434619 CTGCTATGATGCAGATTTCTGGG + Intergenic
945888809 2:215406559-215406581 CTTTTAAGAAGCCAGTTTCTTGG + Intronic
946044254 2:216808006-216808028 CTGGTATCAGGCTGATTTCTAGG + Intergenic
947427857 2:230000054-230000076 CTGATAAGAAGCTGATTATTAGG + Intronic
948931157 2:241133316-241133338 CTGGATAGAAGCCGAAGTCTCGG + Intronic
1169905455 20:10598750-10598772 CTGGTAAGAAGCCGATTTCTTGG + Exonic
1172331907 20:34081277-34081299 CTGGAACAAAGCCTATTTCTGGG - Intronic
1178290178 21:31360851-31360873 CTGGTAATAAGTGGATTTCCTGG - Intronic
1184721627 22:46317861-46317883 CTGGTAAGACGGCGGTTTCTCGG + Intronic
952763286 3:36934265-36934287 CTGAGAAGAAGCCAATTTCTGGG + Intronic
956365035 3:68491884-68491906 TTGTTAAGATGCAGATTTCTGGG - Intronic
960465164 3:117989187-117989209 CTGGGAAGAAGCTGATTTAGAGG - Intergenic
964211477 3:154233129-154233151 CTGGTAAGAAACCCAATTCTAGG - Intronic
964477227 3:157107954-157107976 CTGCTAAAAATCAGATTTCTTGG - Intergenic
966220591 3:177547451-177547473 CTGCTGAAAAGCCGATGTCTTGG + Intergenic
973315865 4:48759538-48759560 CAGCTAAGAATCCGTTTTCTTGG + Intronic
982710564 4:158754675-158754697 CTGTTAAAAATCCTATTTCTGGG - Intergenic
983156918 4:164359873-164359895 CTGCTAAAAACCAGATTTCTGGG - Intronic
992276470 5:75125877-75125899 CAGGTAAAAGGCCTATTTCTTGG - Intronic
1000441028 5:161263373-161263395 CTGGCAAGAAGCCCATGTCCTGG - Intergenic
1000787189 5:165559723-165559745 CTGGTATGTCGCCAATTTCTTGG + Intergenic
1000889065 5:166782654-166782676 CTGGTAACTAGCAGTTTTCTTGG + Intergenic
1001539195 5:172525300-172525322 AGGCTAAGAAGCCGCTTTCTAGG + Intergenic
1001692255 5:173641896-173641918 CTGCTAAAAGGCAGATTTCTGGG + Intergenic
1005855776 6:29862017-29862039 CAGGCAAGAAGCCAACTTCTGGG - Intergenic
1006952148 6:37831688-37831710 ATGGTAAGGAGGGGATTTCTGGG + Intronic
1011657376 6:89564054-89564076 CTAGTAAGGAGGCGATTACTGGG + Intronic
1013720057 6:113014426-113014448 GTGCTAAGGAGCCTATTTCTAGG + Intergenic
1014441719 6:121480941-121480963 CTGCTAAGAAGCAGATTTGGGGG - Intergenic
1016227802 6:141761643-141761665 TTTGGAAGAAGACGATTTCTAGG + Intergenic
1016277339 6:142370206-142370228 CTGGTAAGCATCTGATGTCTGGG - Exonic
1016675140 6:146756382-146756404 CGGGTAAGAATCCCATTTCCAGG + Intronic
1017598166 6:156052610-156052632 CTCTTAAGAATCCTATTTCTGGG - Intergenic
1018315324 6:162550891-162550913 CTGGTGAGAAGACTATTGCTAGG + Intronic
1022119175 7:27290662-27290684 ATGGTAAGAAGCAGATTTGGTGG + Intergenic
1022363301 7:29684800-29684822 CTGGTAAGGAGCCGATCACCAGG + Intergenic
1022424194 7:30252582-30252604 CTGGTAAAATGGCAATTTCTGGG + Intergenic
1022428025 7:30285777-30285799 CTGGTAAGGAGCCGATCACCAGG - Exonic
1022698086 7:32728960-32728982 CTGGTAAGGAGCCGATCACCAGG - Intergenic
1029873671 7:103723857-103723879 CTTGTCAGAAGACTATTTCTAGG - Intronic
1034845712 7:154442803-154442825 CTGGGAAGTAGCTGAATTCTGGG - Intronic
1039215884 8:35270260-35270282 GTGGTAAGCAGTCGATTTCTTGG + Intronic
1046298323 8:112252145-112252167 CTGTTAGGAAGCCCATTTTTGGG - Intronic
1051499408 9:17760740-17760762 CTGATAAGAAAAGGATTTCTTGG + Intronic
1051503338 9:17801862-17801884 GTGCTAAGATGCGGATTTCTGGG + Intergenic
1189645543 X:43125563-43125585 CTGGTGAGAGCCCGTTTTCTAGG - Intergenic
1196576871 X:117328600-117328622 CTGGTCAGATGCCCAGTTCTGGG + Intergenic