ID: 1169908855

View in Genome Browser
Species Human (GRCh38)
Location 20:10630646-10630668
Sequence CATGCTGAGCAGAAGGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169908855_1169908863 6 Left 1169908855 20:10630646-10630668 CCAGCGCCCTTCTGCTCAGCATG 0: 1
1: 0
2: 1
3: 9
4: 152
Right 1169908863 20:10630675-10630697 ATCTGCCTGTGGCAGAGCCTGGG 0: 1
1: 0
2: 1
3: 19
4: 290
1169908855_1169908862 5 Left 1169908855 20:10630646-10630668 CCAGCGCCCTTCTGCTCAGCATG 0: 1
1: 0
2: 1
3: 9
4: 152
Right 1169908862 20:10630674-10630696 CATCTGCCTGTGGCAGAGCCTGG 0: 1
1: 0
2: 2
3: 40
4: 400
1169908855_1169908860 -5 Left 1169908855 20:10630646-10630668 CCAGCGCCCTTCTGCTCAGCATG 0: 1
1: 0
2: 1
3: 9
4: 152
Right 1169908860 20:10630664-10630686 GCATGTGGGCCATCTGCCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 165
1169908855_1169908864 7 Left 1169908855 20:10630646-10630668 CCAGCGCCCTTCTGCTCAGCATG 0: 1
1: 0
2: 1
3: 9
4: 152
Right 1169908864 20:10630676-10630698 TCTGCCTGTGGCAGAGCCTGGGG 0: 1
1: 0
2: 5
3: 37
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169908855 Original CRISPR CATGCTGAGCAGAAGGGCGC TGG (reversed) Intronic
900297195 1:1957729-1957751 CAGGCTGAGCAGGAGGGAGCCGG + Intronic
900426881 1:2585009-2585031 GATGCAGAGCAGAAGGTGGCTGG - Intergenic
901531043 1:9852678-9852700 CTTGCTAATCAGAAGGGGGCTGG + Intronic
903539043 1:24086527-24086549 CATGATGGGTAGAAGGGAGCGGG + Intronic
905773898 1:40655527-40655549 CAAGGTGAGCAGAAGAGAGCAGG + Intronic
908363132 1:63389948-63389970 CATGTTGAGCTGATGGGAGCTGG + Intronic
911275530 1:95853679-95853701 GCTGCTGTGCAGAAGGGGGCAGG + Intergenic
915267795 1:154731434-154731456 CCTGCTGAGCAGGAGGGGCCAGG - Intronic
915492812 1:156260805-156260827 CAGGCAGAGCAGAGGGGCTCAGG + Intronic
915769694 1:158407411-158407433 CTTATTGAGCAGAAGAGCGCTGG + Intergenic
922317857 1:224458353-224458375 TATGCTTAGCAGAGGGGCTCTGG + Intronic
922926185 1:229348588-229348610 GATACTTCGCAGAAGGGCGCAGG - Intergenic
923070547 1:230560601-230560623 CATGCTCTGCAGAAGGGGGTAGG - Intergenic
1068295449 10:55065607-55065629 GATGCTGGGCAGAAGGGCATTGG - Intronic
1069063928 10:63922912-63922934 CAGACTGAGCAGGAGGGCGTCGG + Intergenic
1072026676 10:91467063-91467085 GAAGCTGAGCTGAAGGGAGCTGG + Intronic
1072605990 10:96983146-96983168 GATGCTGAGCAGGAGGGCGAAGG + Exonic
1072720963 10:97780998-97781020 CATGCTGAACAGAAGTCGGCTGG + Intergenic
1073592942 10:104773577-104773599 CATACAGAGCAGAAGGCAGCAGG + Intronic
1075215184 10:120526549-120526571 GAAGCTGTGCAGAAGGGCGTAGG + Intronic
1075940666 10:126388092-126388114 CAGGGCGAGCAGGAGGGCGCGGG + Exonic
1076739932 10:132478089-132478111 CAGGCTGAGGAGAGGGGCCCTGG + Intergenic
1077214323 11:1389141-1389163 CATGCTGCGCTGGAGGGGGCGGG - Intergenic
1078375717 11:10791763-10791785 GAGGCTGAGGAGAAGGGCGCCGG - Intergenic
1081803187 11:45873766-45873788 CAAGCTTAGCAGAAGGCTGCTGG + Intronic
1083782258 11:64924694-64924716 CATCCTGAGCAGCTGGGCGGCGG + Exonic
1085100552 11:73796588-73796610 CTTCCTGGGCAGAAGGGGGCAGG + Intronic
1085868701 11:80325260-80325282 AATGCTGGACAGAATGGCGCAGG + Intergenic
1089927511 11:122274019-122274041 GGTGCTGAGCAGAAGGACTCTGG - Intergenic
1090685912 11:129119278-129119300 TATGCTGAGGAGAAAGGTGCTGG - Intronic
1090936541 11:131348030-131348052 CATGCTGAGGACATGGACGCAGG - Intergenic
1092991440 12:13905850-13905872 GAGGCTGAGCAGAACGGGGCTGG - Intronic
1095311645 12:40705344-40705366 CAAGCTGAGCAGAAGGTCTATGG - Intronic
1107853432 13:44592063-44592085 GCTCCTGGGCAGAAGGGCGCTGG + Intergenic
1113924755 13:113935244-113935266 CCTGAGGAGCTGAAGGGCGCCGG - Intergenic
1117737025 14:58777854-58777876 CATGCAGAGCAGAGGGGCAAGGG - Intergenic
1119388781 14:74276209-74276231 CCTCCTGAGCAGAAGGGCAAGGG + Intergenic
1122658458 14:103278939-103278961 CAGGGAGAGCAGGAGGGCGCGGG + Intergenic
1122931981 14:104937475-104937497 CATGCTGGGCAAAAGGGTGATGG - Exonic
1123037778 14:105478431-105478453 CATGCTGCGCAGAGGGGCGCGGG - Exonic
1124205997 15:27720968-27720990 CATGATGAGCAGGACGGAGCTGG + Intergenic
1125512860 15:40302228-40302250 CATGCTCAGCACCAGGGCTCAGG + Intronic
1126112943 15:45186415-45186437 TCTGCTGAGGAGAAGGGGGCAGG + Intronic
1127861585 15:62998236-62998258 CATGCTGGGCAGGTGGGGGCAGG + Intergenic
1128220979 15:65968401-65968423 CCTGCTAAGCAGGAGGGAGCAGG - Intronic
1128886497 15:71293159-71293181 CATGCTGAGCTGCACGGCACAGG - Intronic
1129256696 15:74337861-74337883 CAGGCTGGGCAGAAAGGAGCAGG + Exonic
1131073282 15:89479303-89479325 CATGGTGAGCATGAGGGCGTTGG - Exonic
1137734576 16:50714215-50714237 CAGGGTGTGCAGAAGGGCTCTGG + Intronic
1139516332 16:67454449-67454471 GAGGCAGAGCAGAAGGGCCCGGG + Intronic
1147445413 17:40472291-40472313 CAGGCTGGGGAGAAGGGTGCTGG - Intergenic
1147458797 17:40555351-40555373 CTTGCTGATGAGAAGGACGCGGG + Exonic
1147706012 17:42425227-42425249 CATGCTGGGTACAAGGGAGCAGG + Intergenic
1149512236 17:57253504-57253526 CATGGAGAGCAGAAAGGCACGGG + Intergenic
1152697260 17:81803582-81803604 CCTGCAGAGCAGACGGGGGCTGG - Intergenic
1152734542 17:81991002-81991024 CATGCTGAGCTGCTGGGAGCAGG + Intronic
1154028073 18:10725893-10725915 CAGGCTGGGCAGGAGGGTGCAGG + Intronic
1154208543 18:12358925-12358947 CATGCTCAGCAGAAAAGAGCTGG + Exonic
1157206711 18:45706905-45706927 AATGGTGAGCAGAAGAGCACAGG + Intergenic
1157576936 18:48749907-48749929 CAGGCCGAGCGGAAGGGCGAGGG + Intronic
1158700520 18:59741737-59741759 CATGCTGAGAAGAGGGGCTTGGG - Intergenic
1160822818 19:1066378-1066400 CGTGCTGGGCAGCAGGACGCAGG - Intronic
1161708574 19:5834306-5834328 CATGCTGACCAGGAGGGCAGTGG + Intronic
1163702130 19:18791231-18791253 CAGGGTGAGCAGAAGAACGCAGG + Exonic
1166897457 19:46032840-46032862 CCTCCTGGGCAGAAGGGGGCAGG + Intergenic
1167129033 19:47572644-47572666 GATTCTGAGCAGAAGGGGCCTGG + Intergenic
1167471723 19:49679450-49679472 CATGAATAGCAGAAGGGAGCGGG - Intronic
1167743444 19:51337960-51337982 CGTGCTGTGCAGTGGGGCGCTGG - Exonic
925804367 2:7633725-7633747 GATTCTGAGCAGAAGGGCTACGG + Intergenic
928113928 2:28532173-28532195 CCTGTTGAGCAGAGGGGCACAGG - Exonic
929811838 2:45195371-45195393 CATTCTAAGTAGAAGGGCTCTGG - Intergenic
931213529 2:60220448-60220470 CATGTTAAGCAGAAGTGCCCAGG + Intergenic
932060836 2:68495946-68495968 CATGCAGGGCAGCAGGGCCCTGG + Intronic
932438686 2:71718148-71718170 CATTCTGAGCAGAAAGGCCTTGG + Intergenic
932588052 2:73044560-73044582 GAGGCTCAGCAGAAGGGCCCGGG + Intronic
933846977 2:86334716-86334738 CAGCCTGAGCAGATGGGCTCTGG - Intronic
934666460 2:96174704-96174726 CATGTTGAGCAGCAGGGGGCAGG - Intergenic
935276404 2:101479409-101479431 CATGCAGAACAGCAGGGAGCAGG - Intergenic
935475999 2:103525177-103525199 CATGATGAGCAAATGGGAGCAGG + Intergenic
937265741 2:120613720-120613742 CCTGCTGAGAAGAAGGGCGTTGG - Intergenic
938339226 2:130524197-130524219 CTAGCTGAGGAGAAGGGAGCAGG - Intronic
938350611 2:130596553-130596575 CTAGCTGAGGAGAAGGGAGCAGG + Intronic
943506359 2:188764431-188764453 CTTGCTGAGAAGAAGGTCTCTGG + Intronic
943525213 2:189007881-189007903 CCTGCTGACCAGCAGGGCCCTGG - Exonic
945443964 2:209913893-209913915 CATGCTGAGCAGGAGCTCCCAGG - Exonic
947224437 2:227826371-227826393 CAAGCTGAGCAGAATGGTGGTGG - Intergenic
947669267 2:231926205-231926227 CAGCGTGAGCAGCAGGGCGCAGG + Exonic
948080660 2:235202784-235202806 CATGCTGAGCACAGGGAAGCAGG - Intergenic
948122583 2:235542280-235542302 CATCCTGAGCATAAGGGCCAGGG + Intronic
948543261 2:238704771-238704793 TATGCTCAGCAGAAAGGTGCTGG - Intergenic
1168750409 20:277833-277855 CCTGCTGAGCAGAGGGGTGGTGG - Intronic
1169093962 20:2879458-2879480 CATGGTGAGCAGGAAGGGGCAGG + Intronic
1169908855 20:10630646-10630668 CATGCTGAGCAGAAGGGCGCTGG - Intronic
1170891033 20:20375532-20375554 TATGCTGAGCAGATGGGTTCTGG + Intergenic
1172392367 20:34574595-34574617 CAGGCAGAGGAGAAGGGGGCCGG - Intronic
1173750089 20:45469810-45469832 CAGGCTGAGGAGGAGGGCGGCGG - Exonic
1174751918 20:53119493-53119515 CATGCTGGGCAGCATAGCGCTGG - Intronic
1175305193 20:57971029-57971051 CATGCTGAACAGATGGGCTGGGG - Intergenic
1178223628 21:30689397-30689419 CATTCTGGGCAGAAGAGGGCAGG + Intergenic
1182593370 22:31399352-31399374 CATGCAGAGCAGCTGGGAGCGGG + Intergenic
1184010332 22:41743173-41743195 CTTGCTGAGCAGGAGGCCCCTGG + Exonic
1184066403 22:42124167-42124189 CCTGCTGAGCAGGAGGTGGCAGG + Intergenic
1184068871 22:42136319-42136341 CCTGCTGAGCAGGAGGTGGCAGG + Intergenic
1184381459 22:44147356-44147378 CCTGCTGGGGAGAAGGGCTCAGG + Intronic
1184495258 22:44837423-44837445 CATGCTGGGCAGGAGGACTCTGG - Intronic
950621773 3:14211754-14211776 CAAGCTGTGCAGCAGTGCGCAGG + Intergenic
950884199 3:16348539-16348561 CCTGCTGACCAGAAGTGCCCTGG - Intronic
955133245 3:56191093-56191115 CAACCTGAGCAGAAGGGCACAGG + Intronic
958950651 3:100412087-100412109 CATGCTGAGAAGTATGGCGCTGG + Intronic
962536099 3:136329829-136329851 CAGGCTGAGCAGAAGGTTGAGGG + Intronic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
968447422 4:658685-658707 CATGATGACCAGGAGGGCTCTGG - Intronic
968663856 4:1810261-1810283 CACGCTGAGGAGGAGGGGGCTGG - Intergenic
969048672 4:4356950-4356972 CAGACAGAGCAGAAAGGCGCAGG - Intronic
978021185 4:103814454-103814476 CATGCTGAGCTGTAGGGTGAGGG + Intergenic
980988632 4:139719024-139719046 CATGCTGGGCAGAGGGGCTCTGG + Exonic
983796942 4:171875633-171875655 CATGCTGAGAAGAAGGGAAACGG - Intronic
984709635 4:182874316-182874338 CAAGCCGAGCAGAACGGGGCAGG - Intergenic
984924065 4:184791333-184791355 CTGGCTGAGCAGAAGAGTGCAGG + Intronic
986035131 5:3929957-3929979 CCTGCTGAGCAGGATGGCACTGG + Intergenic
986782454 5:11079289-11079311 GAGGCTCAGCAGAAGGGAGCTGG - Intronic
990552742 5:56900356-56900378 CATGCTGAGAAGAGTGGAGCGGG - Intergenic
991477871 5:67042799-67042821 CATGCTGAACAGAAAGACACTGG + Intronic
998316087 5:141184176-141184198 CGCGCTGAGCAGAGAGGCGCTGG + Exonic
998317276 5:141194169-141194191 CGCGCTGAGCAGAGAGGCGCTGG + Exonic
1001886299 5:175293483-175293505 CATGCAGAGCACAAGGGATCAGG - Intergenic
1002134294 5:177098450-177098472 AATGCTGAGCAGATGGGGGAGGG - Intergenic
1002363402 5:178691854-178691876 CATGCTGTGCAGAGGGGCCCTGG + Intergenic
1006040231 6:31246449-31246471 CATGAGGAGCTGAAGGGCCCGGG + Intergenic
1006048642 6:31321863-31321885 CATGAGGAGCTGAAGGGCCCAGG + Intronic
1007736719 6:43986615-43986637 TCTGCTGAGCAGAAGTGCACAGG + Intergenic
1014289261 6:119539625-119539647 ATTCCTGAGCAGAAGGGGGCAGG + Intergenic
1017483351 6:154880044-154880066 CATGCTGACCAGGAGGAAGCCGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1021103157 7:16606934-16606956 AAAGCTGAGCAGGAGGGCCCAGG + Intronic
1024964151 7:55006622-55006644 CAGGCTGAGGAGGAGGTCGCTGG + Intergenic
1025020071 7:55473600-55473622 CAAGCTGAGGAGCAGGGCACGGG + Intronic
1028475094 7:91244626-91244648 AATGCTGAGGAGAAGGGAGGAGG - Intergenic
1028908832 7:96185001-96185023 CATGCAAAGCAGAAGGCCTCAGG - Exonic
1034551148 7:151821494-151821516 ACTGCTGAGCAGAAGGCCCCGGG + Intronic
1034681471 7:152931771-152931793 CCTGCTGTGCAGAAGGCCGTAGG - Intergenic
1035021836 7:155805039-155805061 CATTCTGAGCACACGGGCGGGGG - Intronic
1036104293 8:5823811-5823833 CATCCTGAGCAGATGTGCGGTGG - Intergenic
1038038357 8:23704865-23704887 GATTGTGAACAGAAGGGCGCAGG - Intronic
1040024368 8:42768409-42768431 CATGCTGACCAGCAAGGGGCAGG - Exonic
1042540864 8:69906016-69906038 CAGGCTGTGCAGAATGGGGCAGG - Intergenic
1042932582 8:74028107-74028129 CATCCTTTGCATAAGGGCGCTGG + Intronic
1045571813 8:103375462-103375484 TATAATGAGCAGAAGGGAGCAGG + Intronic
1049238132 8:141522981-141523003 CTTGCTGAGCAGAGGGGCTGGGG + Intergenic
1052569114 9:30198614-30198636 CATGCTGAGCGGATGGCCTCTGG + Intergenic
1052756913 9:32551076-32551098 CATGCGCAGCAGATGGACGCCGG + Intronic
1053527078 9:38841187-38841209 CATGCTAAGCAGCACGGCACGGG - Intergenic
1054199301 9:62065618-62065640 CATGCTAAGCAGCACGGCACGGG - Intergenic
1054639052 9:67522739-67522761 CATGCTAAGCAGCACGGCACGGG + Intergenic
1056319055 9:85419527-85419549 CATGCTGATCAGCAGGCCCCAGG + Intergenic
1057548501 9:96035215-96035237 ATTCCTGAGCAGAAGGGGGCGGG + Intergenic
1060047956 9:120355622-120355644 AATGCTGATCAGAAGGGGCCTGG - Intergenic
1060793465 9:126500405-126500427 CACGCTGTGCAGAAAGGAGCTGG - Intronic
1062096851 9:134708027-134708049 GAGGCTGAGCAGCAGGGCCCAGG - Intronic
1194039424 X:88921444-88921466 CATTCTGAGCAGGATGGAGCAGG + Intergenic
1200140938 X:153902642-153902664 CTGGCTGAGCAGAATGGCACTGG + Intronic
1200163736 X:154022207-154022229 CACCCTGTGCAGAAGGGAGCTGG - Intronic
1202368493 Y:24182574-24182596 CATACTGGACAGAAGGGGGCAGG + Intergenic