ID: 1169909518

View in Genome Browser
Species Human (GRCh38)
Location 20:10636220-10636242
Sequence AAGAGAGCCCAGGGCGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169909509_1169909518 20 Left 1169909509 20:10636177-10636199 CCAAGTTTCTGGACTGAAAATTT 0: 1
1: 0
2: 2
3: 36
4: 332
Right 1169909518 20:10636220-10636242 AAGAGAGCCCAGGGCGTTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 169
1169909512_1169909518 -9 Left 1169909512 20:10636206-10636228 CCAGGGCCCCTTTAAAGAGAGCC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1169909518 20:10636220-10636242 AAGAGAGCCCAGGGCGTTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169909518 Original CRISPR AAGAGAGCCCAGGGCGTTCC TGG Intronic
900164446 1:1239184-1239206 GAGTAAGCCCAGGGCGTTCCTGG - Intergenic
900795524 1:4705987-4706009 AAAAGAGCCCAGAGAGTTGCTGG - Intronic
901759484 1:11461360-11461382 AAGAGAGCCCAGAGAGTTCTGGG - Intergenic
902289879 1:15428962-15428984 AAGAGAGCCCAGGGATTGCCAGG - Exonic
904601030 1:31672752-31672774 AAGGGAGACCAGGGCATCCCTGG - Exonic
909919407 1:81361980-81362002 AAGAGGACCAAGGGCTTTCCGGG - Intronic
912568224 1:110604294-110604316 CAGAGAGCTCAGGGCCTGCCAGG - Exonic
915168937 1:153964198-153964220 AAGAGCCCCCAGCGCATTCCAGG + Intronic
919862208 1:201747540-201747562 AAGACAGCAGAGGGTGTTCCAGG + Intronic
919956579 1:202423286-202423308 AAAAGAACCCAGGGACTTCCAGG - Intronic
920351535 1:205341202-205341224 AAGAGAGGCCTGGGAGGTCCTGG - Intronic
920868086 1:209769767-209769789 GAGAGAGCCCATGGCGTCTCGGG + Intronic
920922697 1:210311429-210311451 GAGCGAGCTCAGGGCGTGCCCGG + Intergenic
924216100 1:241824085-241824107 AAGAGGGTCTAGGGCATTCCAGG + Intergenic
1063096226 10:2911388-2911410 AGGAGGGCCCAGGGTATTCCTGG + Intergenic
1067576639 10:47412916-47412938 AGGAGAGCTCAGGGAGCTCCTGG - Intergenic
1071824123 10:89307541-89307563 GAGAGAGCCCAAGGAGTTCTGGG + Exonic
1074212988 10:111354985-111355007 AACAGAGCCCAGGCCATTCAGGG + Intergenic
1075071340 10:119321786-119321808 AAGTGAGCCCAGGCCGTAGCTGG + Intronic
1075294806 10:121265481-121265503 AAGAGAGGCATGGGCATTCCTGG - Intergenic
1075485547 10:122819325-122819347 AAGACACCCCAGGGTGTCCCTGG + Intergenic
1076701494 10:132275492-132275514 AAGAGAGCCCAGGACATCCTAGG + Intronic
1076842874 10:133055092-133055114 AAGAGAAACCAGGGAGATCCAGG - Intergenic
1077080911 11:724395-724417 ACCAGAGCCAGGGGCGTTCCTGG - Intronic
1078840752 11:15073982-15074004 AAGACGGCGCAGGGCGCTCCCGG - Intronic
1079810090 11:24987667-24987689 AAGAGAGCCCCATTCGTTCCAGG - Intronic
1082873147 11:57962114-57962136 GAGAGATCCAAGGGTGTTCCAGG - Intergenic
1083281255 11:61628573-61628595 TAGAGAGGCCAGGGCTTGCCTGG + Intergenic
1083661243 11:64252574-64252596 AAAAGAGCCCAGAGTCTTCCAGG - Intronic
1083883762 11:65560773-65560795 AAGAGAGCCCAGGGTGCCCAGGG + Intergenic
1084368548 11:68720469-68720491 AAGAGAGCCCTGGGTTTTCCAGG - Intronic
1084480203 11:69415656-69415678 ATGGGAGCCCAGGGCGAGCCTGG + Intergenic
1088897134 11:114087027-114087049 CACAGATCCCAGGGAGTTCCAGG - Intronic
1094846201 12:34362455-34362477 AAGGGAACCCAGGGCATCCCTGG - Intergenic
1095716009 12:45346764-45346786 AGGACAGCCAAGGGCCTTCCAGG + Intronic
1102821830 12:115915086-115915108 AGGAGAGGCAAGGGCATTCCAGG + Intergenic
1103332191 12:120162032-120162054 AAGGGAGCCCATGGCATTCATGG + Exonic
1103616422 12:122155753-122155775 GAGAGAGCGCTGGGCCTTCCAGG - Intergenic
1104569467 12:129912333-129912355 AGGAGAGACCAGGGGGCTCCTGG + Intergenic
1106386959 13:29296294-29296316 ACCAGAGCCCAGGGAGGTCCAGG - Intronic
1108486589 13:50933091-50933113 AATATTCCCCAGGGCGTTCCTGG - Intronic
1113102834 13:106738610-106738632 AAGAGAACCCTGGGCTTTTCTGG + Intergenic
1113641788 13:111962901-111962923 GGGAGAGTCCAGGGGGTTCCCGG - Intergenic
1113732129 13:112649075-112649097 AAGAGAACCCAGTGTGTTCTCGG - Intronic
1116938858 14:50770393-50770415 AAGAGAGGGCAAGGCGGTCCCGG + Exonic
1119719842 14:76883319-76883341 AGGAGGGCCTAGGGCTTTCCGGG + Intergenic
1120705393 14:87740184-87740206 AAGGGAGACTAGGGGGTTCCTGG + Intergenic
1121248774 14:92484104-92484126 AAGAGAGCCCAGCACATTCTAGG + Intronic
1122810740 14:104286643-104286665 TTGAGGGCCCAGGGCCTTCCAGG + Intergenic
1123131687 14:105991781-105991803 AACAAAGCCCAGGGTGTCCCTGG + Intergenic
1124042175 15:26115781-26115803 AAGAGGGCCGAGAGTGTTCCGGG - Intergenic
1124154653 15:27215268-27215290 AAGAGAAGCCAGGGAGTTCAGGG - Intronic
1125306781 15:38326367-38326389 AAAAGAACCCAGGGCTTTGCTGG + Intronic
1125608189 15:40953878-40953900 CAGAGAGCCCCGGACATTCCAGG - Intronic
1127161558 15:56192515-56192537 AAGTGAGCCCATGGGGTACCTGG + Intronic
1127956724 15:63860205-63860227 AAGAGAGCCAAGGCCATTGCTGG + Intergenic
1128485491 15:68082296-68082318 AAGAGAGACAAGGGAATTCCTGG + Intronic
1133338362 16:5021037-5021059 AAGGGAGCCCAGGGCCTCCAGGG + Intergenic
1134160976 16:11889287-11889309 AACAGAGCCTAGGTCGTGCCCGG + Intronic
1134568952 16:15275060-15275082 ATGACAGCCCAGGGTATTCCAGG - Intergenic
1134733482 16:16481302-16481324 ATGACAGCCCAGGGTATTCCAGG + Intergenic
1134934020 16:18230980-18231002 ATGACAGCCCAGGGTATTCCAGG - Intergenic
1137592941 16:49704903-49704925 GAGGGAGCCCAGGGAGTTCTAGG - Intronic
1138190030 16:55007322-55007344 GAGAAAGCCCAGGGCGTTTTTGG - Intergenic
1138208875 16:55146190-55146212 AAGAGAGAGGAGGGCATTCCAGG - Intergenic
1138231705 16:55342343-55342365 AAAAGAGACCAGTGCTTTCCAGG - Intergenic
1138507613 16:57486096-57486118 GAGAGAGCGCAGGGAGTTTCAGG + Intronic
1139629214 16:68218143-68218165 ACTTGAGCCCAGGGAGTTCCAGG - Intronic
1140257032 16:73346300-73346322 GGGAGAGCCCAGAGTGTTCCAGG - Intergenic
1141076043 16:81007280-81007302 AAGAGAGCCCCGGGCGGCACTGG + Intronic
1141192292 16:81833440-81833462 AGGAGAGGCCAGGGGCTTCCAGG - Intronic
1141637270 16:85320898-85320920 AAGGGAGCTCTGGGTGTTCCGGG - Intergenic
1141928109 16:87182454-87182476 AAGGGAGCCCAGGGCTTTCTGGG + Intronic
1143619904 17:8074807-8074829 GAGAGAGCATAGGGAGTTCCAGG - Intronic
1145068700 17:19783877-19783899 AAGAGAGCCCCCGGAGTTGCTGG + Exonic
1149491309 17:57086435-57086457 ATGGGAGCCCTGGGCGTTTCGGG + Intronic
1203173525 17_GL000205v2_random:174296-174318 AGGAGAGCACAGGGTTTTCCAGG - Intergenic
1155275580 18:24184435-24184457 AAGAGAGAGCAGGGCATTCCAGG - Intronic
1155438166 18:25834254-25834276 CAGAGTTCCCAGGGCGTTCAGGG - Intergenic
1156887437 18:42151767-42151789 AAGTGTGCCCAGGGTGTTGCTGG - Intergenic
1157211728 18:45748561-45748583 AAGAAAGGCCAGGGAGCTCCAGG - Intronic
1160197887 18:76771804-76771826 AAGAGAGTTCAGGGCCTTCAAGG + Intergenic
1160963523 19:1735285-1735307 ACTAGAGCCCAGGGAGGTCCTGG - Intergenic
1161076488 19:2288350-2288372 CAAAGAGCACAGGGGGTTCCCGG - Intronic
1161156183 19:2732923-2732945 GAGAGCGCCCAGGGCGTGCCGGG - Exonic
1161621950 19:5302618-5302640 AAGAAAGCCCAGGGAGATTCAGG - Intronic
1163439747 19:17316114-17316136 AGGAGTGCCCTGGGCGATCCAGG + Intronic
1163723691 19:18910624-18910646 AAGACAGCCCAGGGCGCAGCGGG - Intronic
1165240430 19:34462479-34462501 AAGAATGCCAAGGGCATTCCTGG + Intronic
1165708255 19:37991550-37991572 AAGCCAGCCCAGGGCTTTCCAGG - Intronic
1166695228 19:44848054-44848076 AAGAGAGCTCAGGGGGATCTTGG + Intronic
1167732478 19:51268700-51268722 AGGAGAGTCCAGGGGGCTCCAGG - Exonic
1168190424 19:54734574-54734596 AAGACAGCCCAGGCTGTTCTGGG + Intronic
1168202773 19:54828674-54828696 AAGACAGCCCAGGCTGTTCTGGG + Intronic
925286600 2:2720502-2720524 AGGGGAGGCGAGGGCGTTCCTGG - Intergenic
929126007 2:38523351-38523373 CAGTGAGCTCAGGGCCTTCCTGG + Intergenic
929776344 2:44933204-44933226 AAGAGTGGCCAGGGCTCTCCTGG + Intergenic
931500078 2:62855620-62855642 GACAGAGCCCAGGGCTTTCATGG - Intronic
932950853 2:76291309-76291331 GAGAGAGCCCAGGGAGTTGGAGG + Intergenic
933291987 2:80448120-80448142 AAAAGAGCCCAGGGCCTTCCTGG - Intronic
937123819 2:119460198-119460220 AAGGCAGCACAGGGCATTCCTGG + Intronic
938376107 2:130807823-130807845 AAGAGAGCCCAGTTCCTCCCAGG - Intergenic
938406335 2:131035132-131035154 CAGGGCGCGCAGGGCGTTCCCGG - Intronic
941492346 2:166157982-166158004 AAGAGAGAGCAGAGGGTTCCAGG - Intergenic
944674640 2:202024897-202024919 AATTGAGCCCAGAGAGTTCCAGG + Intergenic
945658856 2:212659526-212659548 AAGAGAGCCCTGCTCTTTCCAGG + Intergenic
948807976 2:240461120-240461142 GGGACAGGCCAGGGCGTTCCAGG + Intronic
1169909518 20:10636220-10636242 AAGAGAGCCCAGGGCGTTCCTGG + Intronic
1172081557 20:32345113-32345135 GAGGGAGCCCAGGGCATTCTGGG + Intergenic
1172114503 20:32565512-32565534 CAGAGAGCCCAGGGGGTGCGGGG - Intronic
1172631092 20:36378727-36378749 CAGAGAGCCCAGGCCTTGCCGGG - Intronic
1176103261 20:63374145-63374167 AAGGGAGCCCGGGACGTCCCGGG + Intronic
1176135359 20:63520067-63520089 TGGGGAGCCCAGAGCGTTCCCGG - Intergenic
1180180010 21:46114025-46114047 CAGAGGGCCCAGGGATTTCCAGG - Exonic
1181310814 22:21943816-21943838 AACAGAGCCCAGGGGTTTGCTGG - Intronic
1181922383 22:26330493-26330515 AAGAGAGGAGAGGGCTTTCCAGG + Intronic
1182116194 22:27757864-27757886 AAGCAAGCCCCGGGCATTCCAGG + Intronic
1182210795 22:28675653-28675675 AACTGAGCCCAGGGAGGTCCAGG + Intronic
1183215168 22:36474722-36474744 TACAGAGCCGAGGGCGCTCCTGG - Intronic
1183334936 22:37241143-37241165 AATAGAGCGCAGGGCCTCCCAGG + Intronic
1183371728 22:37436344-37436366 AAGATAGCACAGAGAGTTCCCGG + Intergenic
1185322996 22:50210447-50210469 TAGAGAGTCCAGGGCAATCCCGG + Intronic
950189983 3:10969986-10970008 AAGACAGGCCTGGGCATTCCAGG + Intergenic
954082289 3:48219714-48219736 CAGAAAGCCCAGGGCTTTGCAGG - Intergenic
954135555 3:48580597-48580619 AAGGGAGACCAGGGAGATCCTGG - Exonic
956726349 3:72159635-72159657 GGGAGAGCCAAGGGCATTCCAGG + Intergenic
962986158 3:140537921-140537943 AAGGGAGCCCTGGGGTTTCCAGG + Intronic
966421568 3:179739357-179739379 ACCAGAGCACAGGGAGTTCCAGG - Intronic
968552632 4:1231509-1231531 AACAGACCCCAGGACGCTCCTGG + Intronic
969135553 4:5025943-5025965 AACACAGCCCAGGGTGGTCCAGG + Intergenic
970194486 4:13541727-13541749 AATAGAGCCCAGGGGCTTCCAGG + Exonic
972245958 4:37245302-37245324 AAGGGAGCGCAGGGCGCACCGGG - Intronic
973621112 4:52726937-52726959 GTGACAGCCCAGGGCTTTCCTGG - Intronic
973785932 4:54332759-54332781 AAGAGAGGCCAGGGCCTAACTGG - Intergenic
980168890 4:129262643-129262665 AATAGAGGACAGGGCATTCCAGG + Intergenic
981818785 4:148862267-148862289 AATGGAGCCCAGGGCATTTCTGG - Intergenic
983852912 4:172605583-172605605 AAGAGAATCCAGGACATTCCAGG + Intronic
984640319 4:182157761-182157783 AGGAGAGGTAAGGGCGTTCCAGG + Intronic
990625382 5:57604892-57604914 AAGTGAGCCGAGGGCATTCTAGG + Intergenic
990857058 5:60280027-60280049 AAGAAAACCCAGGGCACTCCAGG + Intronic
995254420 5:110030128-110030150 AGGAGAGCTCATGTCGTTCCTGG + Intergenic
995442210 5:112204512-112204534 AAAAGAGCCCAGAGAGTTCCTGG + Intronic
1001087651 5:168712690-168712712 AAGAGACCCAAGGGAGTTACTGG + Intronic
1002827959 6:790906-790928 GAGAGAACCCAGGGAGTTCGAGG + Intergenic
1005939276 6:30548588-30548610 AAGTGGGACCAGGGAGTTCCAGG - Intronic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1007760472 6:44130520-44130542 ACCTGAGCCCAGGGAGTTCCAGG - Intronic
1011557556 6:88586439-88586461 AGGAGAGCCCAGCTCCTTCCTGG + Intergenic
1011788244 6:90869654-90869676 AAGAGAGGTCAGGGCGATGCTGG + Intergenic
1013276019 6:108585561-108585583 AAGAGGGCAGAGGGCCTTCCTGG - Intronic
1018927347 6:168215422-168215444 AATGGAGCCCAGGGCTTCCCTGG - Intergenic
1019120529 6:169800501-169800523 CAGGGAGCCCAGGTCGGTCCGGG - Intergenic
1019597221 7:1863729-1863751 ACGGGAGCCCACGGTGTTCCGGG - Intronic
1026671530 7:72395040-72395062 ATGCAAGCTCAGGGCGTTCCTGG - Intronic
1026778251 7:73245499-73245521 ACCTGAGCCCAGGGAGTTCCAGG - Intergenic
1027019104 7:74798893-74798915 ACCTGAGCCCAGGGAGTTCCAGG - Intronic
1027068923 7:75147044-75147066 ACCTGAGCCCAGGGAGTTCCAGG + Intronic
1032264245 7:130359698-130359720 AAGAGAGCCCAGAGCTTGCCCGG - Intronic
1034227201 7:149493455-149493477 AACAGAGTCCAGGCCCTTCCTGG + Intronic
1034242388 7:149620523-149620545 AACAGAGTCCAGGCCCTTCCTGG + Intergenic
1035964267 8:4172872-4172894 AAGGGAGCCCAGCCCATTCCAGG + Intronic
1037835555 8:22213039-22213061 AAGAAAGCCCAGGGCAGCCCCGG + Intergenic
1037901471 8:22691831-22691853 GCGAGAGCCCAGCGCGCTCCGGG - Intronic
1040325374 8:46338905-46338927 AGGAGATCCCAGGGCTGTCCTGG + Intergenic
1040829917 8:51664924-51664946 AAGAAAGGCAAGGGCATTCCAGG - Intronic
1044168523 8:89019497-89019519 ACTTGAGCCCAGGGAGTTCCAGG + Intergenic
1044250742 8:90001675-90001697 GAGAGAGGACAGGGCGTCCCGGG + Intronic
1044250760 8:90001738-90001760 GAGAGAGGACAGGGCGTCCCGGG + Intronic
1047508435 8:125497832-125497854 AGGAGAGCCCAGAGCTTGCCGGG + Intergenic
1049357673 8:142196729-142196751 AAGAGGCCTCAGGGCGTGCCTGG + Intergenic
1056792476 9:89634927-89634949 GACAAAGCCCAGGGTGTTCCTGG + Intergenic
1058597437 9:106630146-106630168 AAAAGAGCCCAGAGAGTTCTGGG + Intergenic
1059337221 9:113576700-113576722 GACAGAGCCCAGGGTCTTCCAGG + Intronic
1060374790 9:123108325-123108347 AAAAGAGCCAAGGGCGTCACAGG - Intergenic
1061378976 9:130242948-130242970 AGGAGAGGCAAGGGCATTCCAGG + Intergenic
1062038471 9:134393190-134393212 AAGAGCGCCCAGGTCGCTCATGG - Intronic
1190496582 X:51032995-51033017 GGCAGAGCCCAGGGAGTTCCAGG - Intergenic
1190509390 X:51160942-51160964 GGCAGAGCCCAGGGAGTTCCAGG + Intergenic
1190759711 X:53429332-53429354 AAAAGAGCAAAGGGCATTCCAGG - Intronic
1198963946 X:142208152-142208174 CAGGGAGCCCAGGGAGTTTCAGG - Intergenic
1199540405 X:148952318-148952340 AAGAGAGCCCAGTATGGTCCTGG - Intronic
1202578014 Y:26347892-26347914 AAAAGAACCCAGGGACTTCCAGG + Intergenic