ID: 1169912735

View in Genome Browser
Species Human (GRCh38)
Location 20:10660550-10660572
Sequence CAGGGCAATCCTAGGGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169912728_1169912735 24 Left 1169912728 20:10660503-10660525 CCAGCTTCTGAGGCTGGTATCAA 0: 1
1: 0
2: 0
3: 9
4: 212
Right 1169912735 20:10660550-10660572 CAGGGCAATCCTAGGGGTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169912735 Original CRISPR CAGGGCAATCCTAGGGGTGC AGG Intronic
900989437 1:6091542-6091564 CAGTGCAAGCCCAGGGGTGGGGG - Intronic
901773629 1:11544112-11544134 CAGGGCAATGCCAGGGTTCCTGG + Intergenic
901805596 1:11736536-11736558 CAGGGGAATTCTGGGCGTGCAGG - Intronic
903471679 1:23591843-23591865 CAGGCCAAGCCTGGGGGTGGGGG + Intronic
904273343 1:29364607-29364629 CAGGACAATCATAGTGGTGGTGG + Intergenic
904456427 1:30650937-30650959 CTGGGTAATCCTAGGCTTGCAGG - Intergenic
904920515 1:34004279-34004301 CAGGGAAATCCAAAGGGTGGCGG - Intronic
905547307 1:38810084-38810106 CAGGGCAGTCCTAGAAGTGAAGG - Intergenic
907029597 1:51157801-51157823 GAGGAAAATCCAAGGGGTGCGGG + Intergenic
908024821 1:59939503-59939525 CAGTGCAATCCTAGTGGTGGCGG - Intergenic
911241273 1:95470430-95470452 CAGGGCAATTCTAGGTGTGATGG - Intergenic
914674054 1:149894350-149894372 CAGGGAAAGCCTAGGTGTGAAGG - Intronic
914838947 1:151231859-151231881 CAGGGCAGTTTTAGGGGTTCAGG + Intronic
915186150 1:154106586-154106608 CAGTGCAGTCCTAGTGGTGGTGG + Intronic
917306369 1:173628860-173628882 CAGGGCAGTCCTAGTGGTGGTGG + Intronic
917919977 1:179743285-179743307 CAGGGCAGTCCTCGGAGCGCCGG + Exonic
918126966 1:181592652-181592674 CTAGGCAATCTGAGGGGTGCTGG + Intronic
920174455 1:204091497-204091519 CTGGGCAAGGCTAGGGGTGAGGG + Intronic
920728357 1:208459166-208459188 CATGGCAATCCTAGGTGAACTGG - Intergenic
922320384 1:224481669-224481691 CAGTGCAATCCCAGTGGTGGTGG - Intronic
922569662 1:226626547-226626569 CAGGGCATTCCTGGGGGTACAGG + Intergenic
1064589131 10:16870466-16870488 TAGGGCAATCCTACCAGTGCTGG - Intronic
1064992473 10:21268058-21268080 CAAGGCAATCCTAGGAGTCTTGG - Intergenic
1069956271 10:72053837-72053859 CAGGGTGATCCTGGGGGTCCTGG + Intergenic
1070915146 10:80148679-80148701 CAGTGCAGTCCTAGTGGTGGTGG + Intergenic
1072573718 10:96680462-96680484 CAGGGCATTCCTGAGGGTGGAGG - Intronic
1075675574 10:124293624-124293646 CAAGGCAACCCTGGGGGTGCAGG + Intergenic
1076679974 10:132166772-132166794 CAGTGCGTTCCTAGGGGTGGCGG + Intronic
1078266397 11:9758731-9758753 CAGGGCCCTCCTCGGGGTCCCGG - Intergenic
1079237423 11:18700339-18700361 GAGGGCTATGCTAGGGATGCTGG - Intronic
1080385457 11:31808414-31808436 CAGGGCATGGCTATGGGTGCCGG - Intronic
1082122640 11:48396122-48396144 CAGTGCAATCATAGTGGTGGTGG - Intergenic
1083158523 11:60840592-60840614 CAGGGCAAGCCAAGGGGGACTGG + Intergenic
1083303721 11:61752447-61752469 CTGGGCAGTCCTAGGCTTGCGGG - Intergenic
1085372196 11:76019747-76019769 CAGGGAAATCCCAGTGGTGGAGG - Intronic
1085400505 11:76232959-76232981 CAGGACCACCCTAGGGGGGCAGG - Intergenic
1087195457 11:95300178-95300200 CAGGGGAGACCTGGGGGTGCAGG + Intergenic
1087402292 11:97683560-97683582 CAGCGCAGTCCTAGGGTTGGTGG - Intergenic
1094258682 12:28465425-28465447 CAGCACAGTCCTAGGGGTGGTGG + Intronic
1094291712 12:28858034-28858056 CAGGGCAATCCCACAGATGCTGG - Intergenic
1094573456 12:31662343-31662365 CAGAGCAATGCTAGGCGTGGTGG + Intronic
1095099443 12:38165436-38165458 CAGGGCAGTCATAGTGGTGGTGG - Intergenic
1096559826 12:52428178-52428200 CTGGGCATTCCTAGGGGCTCGGG - Intronic
1096577461 12:52562182-52562204 CAAGGCAAGCCTGGGGGAGCTGG - Intergenic
1097167157 12:57092009-57092031 AAGGGCAATCCTAGGAGGCCTGG - Intronic
1099523417 12:83690858-83690880 CAGCACAATCCCAGTGGTGCTGG + Intergenic
1100404796 12:94263602-94263624 CAGGGCATTACTTGGGGTGGGGG + Intronic
1105432438 13:20349768-20349790 CAGGGCAAAGCTGGGTGTGCTGG + Intergenic
1107019974 13:35741336-35741358 CAGAGCAGTCCGAGGGCTGCTGG + Intergenic
1107466988 13:40660160-40660182 CAGGGAGATCCTGGGGGGGCTGG + Intronic
1107552101 13:41487018-41487040 CAGAGCAGTCCTAGGGTTGGTGG - Intergenic
1108621599 13:52190290-52190312 CAGGGGAGGCCTGGGGGTGCTGG + Intergenic
1108665087 13:52621588-52621610 CAGGGGAGGCCTGGGGGTGCTGG - Intergenic
1108844686 13:54663172-54663194 CAGAGCAGCCCTAGGGCTGCCGG + Intergenic
1111702134 13:91704406-91704428 CAGAGCATTCCTAGGGGATCTGG + Intronic
1115961134 14:38837124-38837146 CAGAGCCATCCTAGTGGGGCAGG + Intergenic
1116282732 14:42929105-42929127 CATGGCAAGCCTTGGGGTGTGGG + Intergenic
1116422237 14:44745666-44745688 CAGCGCAGTCCTAGTGGTGGTGG + Intergenic
1118884699 14:69856588-69856610 CAGGGCAATCCTCTGGATGGTGG + Intronic
1121153065 14:91654831-91654853 CAGTGCAGTCCTAGTGGTGGTGG + Intronic
1121694318 14:95900485-95900507 CAGGCCCATCCCAGGGCTGCTGG + Intergenic
1122204839 14:100143216-100143238 CAGGGCAGTCCCTGGGGTCCAGG + Intronic
1202872475 14_GL000225v1_random:177382-177404 CAGGGCAACCGTAGGGACGCCGG - Intergenic
1123736932 15:23194696-23194718 GAGGGTGATACTAGGGGTGCTGG + Intergenic
1124287630 15:28417673-28417695 GAGGGTGATACTAGGGGTGCTGG + Intergenic
1124288151 15:28423374-28423396 GAGGGTGATACTAGGGGTGCTGG + Intergenic
1124295073 15:28493953-28493975 GAGGGTGATACTAGGGGTGCTGG - Intergenic
1126228285 15:46296421-46296443 CAGGGCAGTCCGAGGCGAGCCGG + Intergenic
1127800104 15:62470585-62470607 CAGGCCACTCTTAGGGCTGCTGG - Intronic
1128364593 15:66988734-66988756 CAGTGCAGTCCTAGTGGTGGTGG + Intergenic
1130530512 15:84744479-84744501 CATGGCAAGCTTAAGGGTGCAGG + Intergenic
1130674751 15:85941805-85941827 CAGGCCATTCCTAGGGGAGTTGG + Intergenic
1130894279 15:88158395-88158417 CAGCCCAACCCTAGGGGAGCAGG - Intronic
1132975472 16:2709187-2709209 CTGGGCCATCCACGGGGTGCCGG + Intergenic
1134907293 16:17991111-17991133 CAGGGCATTCCTTTGGGTGTTGG + Intergenic
1137590429 16:49690036-49690058 CAGGACACCCCTGGGGGTGCAGG - Intronic
1139087248 16:63602463-63602485 TAGGGCATTCCTTGGGGAGCAGG + Intergenic
1140233397 16:73136790-73136812 TAAGACAATTCTAGGGGTGCAGG + Intronic
1141186960 16:81794844-81794866 CAGGACAATCCATCGGGTGCAGG - Intronic
1142218596 16:88841855-88841877 CAGGGACACCCTTGGGGTGCAGG - Intronic
1142607164 17:1088254-1088276 GAGAGCAAACCTAGGGTTGCTGG - Intronic
1144766905 17:17738000-17738022 CAGTGCCATCCCAGGGGGGCAGG + Intronic
1147365656 17:39957457-39957479 GAGGACAAGCCTAGGGGAGCTGG + Intergenic
1150809299 17:68344214-68344236 AAGTGCAATTCTTGGGGTGCAGG - Intronic
1151715023 17:75826947-75826969 CAGGGGCCTCCCAGGGGTGCAGG - Intergenic
1154209219 18:12365125-12365147 CAGAGCAATCCCAGAGGGGCTGG + Intronic
1155526527 18:26721514-26721536 CAGGGAAAGCCTAGGGATGCAGG - Intergenic
1155721072 18:29012652-29012674 CAGGGAACTCCTAGGGGAGCCGG + Intergenic
1156111341 18:33730752-33730774 CAGGGCACTTGTATGGGTGCTGG - Intronic
1157710689 18:49847779-49847801 CAGGGCAAACCCAGGTGTTCAGG + Intronic
1161039266 19:2101382-2101404 CTGGGCCTTCCTAAGGGTGCTGG + Exonic
1164147115 19:22518860-22518882 CAGGGCAATTCTAGGGGCTGGGG + Intronic
1165060415 19:33202469-33202491 CTGGGCAGGCCTAGGGGTGTGGG + Intronic
1165386357 19:35512711-35512733 CAGGGCAATCCTGGAGGTCTGGG - Exonic
1166656542 19:44616120-44616142 CAGGACAAGCGTAGGGGTGGAGG + Intronic
1166930439 19:46298468-46298490 AAGGGCCATCCAGGGGGTGCAGG - Intronic
1166943474 19:46383257-46383279 CAGGGCAGGCCTGGGGGAGCGGG - Intronic
1167019639 19:46863621-46863643 AAGGACACTCCTAGGGTTGCTGG - Intergenic
1167445849 19:49537160-49537182 GAGGGAACTCCTCGGGGTGCAGG - Exonic
1168297613 19:55385054-55385076 CAGGGCCACCCTAAGGGGGCAGG - Intergenic
925413962 2:3656637-3656659 CAGGGCGATGCTGGGGCTGCTGG - Intergenic
927684383 2:25160683-25160705 TACGGCCATCCTAGAGGTGCTGG + Intergenic
928670496 2:33598955-33598977 CTGGGCAGGCCTAGGGGTGTTGG + Intronic
929664268 2:43821680-43821702 CAAGGAAATCTTAGGGGTCCAGG - Intronic
929727449 2:44445435-44445457 CAAGGGAATCCCAGGGGTTCGGG - Intronic
930439570 2:51389847-51389869 CAGGGCAATCCCAATGGTGGTGG - Intergenic
930880327 2:56263187-56263209 TACAGCAATCCTAAGGGTGCTGG - Intronic
931980066 2:67685235-67685257 CAGGGCAAGCCTTGGGGAGGAGG - Intergenic
932475536 2:72003570-72003592 CAGTGCTCACCTAGGGGTGCTGG - Intergenic
936010388 2:108921696-108921718 CAGGGCAGGCCCAGGGGTGGAGG + Intronic
943208098 2:184927416-184927438 CAGTGCAATCCCAGTGGTGGTGG - Intronic
943821403 2:192327211-192327233 CAGGGTAATCCTAAGGGGGCAGG + Intergenic
944616277 2:201464508-201464530 CAGTGCAGTCCTAGTGGTGGTGG - Intronic
945768089 2:214004709-214004731 CTGGGTCATCCTAGGGATGCAGG + Intronic
947712509 2:232324112-232324134 CTGGGCAACCCATGGGGTGCAGG - Intronic
948133575 2:235619557-235619579 CTGGTCAATCCTGGGGCTGCTGG + Intronic
948814771 2:240504252-240504274 CAGGGCACCCCTAGGGTTTCAGG + Intronic
1169017557 20:2304267-2304289 CAGAGCAATCCTAGGGTTAAGGG + Intronic
1169092764 20:2871878-2871900 CAGGGCCAGCCTAGAGGTGAGGG - Intronic
1169912735 20:10660550-10660572 CAGGGCAATCCTAGGGGTGCAGG + Intronic
1170873712 20:20231725-20231747 CAGGGCAAGGCTAGGGCTGTGGG + Intronic
1171256332 20:23691380-23691402 CATGGCTATTCTAGGGGTGCTGG - Intergenic
1171263688 20:23753290-23753312 CACGGCTATTCTAGGGGTGCTGG - Intergenic
1171279180 20:23881917-23881939 CATGGCTTTTCTAGGGGTGCTGG - Intergenic
1171820672 20:29834867-29834889 CAGGGCAGTCATAGTGGTGGTGG + Intergenic
1172425013 20:34850087-34850109 CAGGGCTGTCCCAGGGGTGATGG + Intronic
1173962512 20:47085869-47085891 CAAGGAAATTCTTGGGGTGCTGG + Intronic
1174203027 20:48820304-48820326 CAGAGTAACCCTAGGAGTGCTGG + Intronic
1174831744 20:53820025-53820047 CAGTGCAGTCCTAGCGGTGGTGG - Intergenic
1175169744 20:57071890-57071912 CAGGTGAATCCTAGTGGAGCTGG + Intergenic
1175245951 20:57582046-57582068 CAGGGGAACCCTAGTGGTGCTGG - Intergenic
1178536477 21:33414226-33414248 CATCGCAATCACAGGGGTGCTGG - Intronic
1180324705 22:11359816-11359838 CAGGGCAGTCATAGTGGTGGTGG + Intergenic
1180825433 22:18857919-18857941 CAGGGCCCTCCCAGGGATGCTGG + Intronic
1181187298 22:21116628-21116650 CAGGGCCCTCCCAGGGATGCTGG - Intergenic
1181211900 22:21293865-21293887 CAGGGCCCTCCCAGGGATGCTGG + Intergenic
1181397598 22:22633021-22633043 CAGGGCCCTCCCAGGGATGCTGG - Intergenic
1181500346 22:23312391-23312413 CAGGGCCCTCCCAGGGATGCTGG - Intronic
1181651808 22:24263037-24263059 CAGGGCCCTCCCAGGGATGCTGG + Intergenic
1181705568 22:24647702-24647724 CAGGGCCCTCCCAGGGATGCTGG - Intergenic
1182770518 22:32792619-32792641 CAGGCAATTTCTAGGGGTGCGGG - Intronic
1184530832 22:45054414-45054436 CTGGGTCATCCTAGGAGTGCTGG + Intergenic
1203275580 22_KI270734v1_random:83822-83844 CAGGGCCCTCCCAGGGATGCTGG + Intergenic
950655369 3:14433130-14433152 CAGGGCCATCACAGGGGTACTGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
954090428 3:48279628-48279650 CAGTGCAATCCCAGGGGTCTTGG + Intronic
954316421 3:49804036-49804058 CAGGGCAGGCATAGGGGTGCTGG - Intronic
957085632 3:75674356-75674378 CAGGGCAGTCATAGTGGTGGTGG - Intergenic
961952401 3:130763201-130763223 CAGTGCAGTCCTAGTGGTGAAGG + Intergenic
965160577 3:165128775-165128797 CAGCACAGTCCTAGGGGTGGTGG - Intergenic
968545496 4:1195681-1195703 CAGGGGCATCCCAGGGCTGCTGG - Intronic
969937505 4:10696739-10696761 GAAGGCAATCCTAGGGAGGCTGG - Intergenic
972915592 4:43874273-43874295 CAGTGCAGTCCTAGTGGTGGTGG - Intergenic
974771792 4:66423797-66423819 CAGCACAATCCTAGAGGTGGTGG + Intergenic
975313037 4:72924937-72924959 CAGCACAGTCCTAGGGGTGGTGG - Intergenic
977074109 4:92432161-92432183 CAGAGCAGTCCTAGTGGTGGTGG - Intronic
977961831 4:103094856-103094878 CAGGGCTATCCTAGAGGAGGAGG + Intronic
979583127 4:122383347-122383369 TAGGGCAATCCAAGGGGTGGGGG + Intronic
985444381 4:190013169-190013191 CAGGGCAGTCATAGTGGTGGTGG + Intergenic
987757114 5:22110520-22110542 CAGTGCAATCATAGGGTTGTGGG + Intronic
989086900 5:37685623-37685645 CAAGTCAATCCTAGGGGTATGGG + Intronic
989722986 5:44552241-44552263 CAGCGCAATCATAGTGGTGGTGG - Intergenic
991107363 5:62860381-62860403 CAGGGCAATCCCAGTGGTGGTGG - Intergenic
991682020 5:69149479-69149501 CAGAGCAGTCCTAGTGGTGGTGG - Intergenic
993192233 5:84696888-84696910 CAGTGCAATCCTAGGGGCAGTGG + Intergenic
993278760 5:85898091-85898113 CAGTGCAGTCCTAGTGGTGGTGG - Intergenic
993905756 5:93621334-93621356 CAGGGCACAACTAGGGCTGCGGG + Intronic
994853925 5:105091694-105091716 CAGTGCAATCATAGGGCTGGTGG + Intergenic
995697694 5:114899001-114899023 CAGAGCAGTCCTAGTGGTGTTGG - Intergenic
997810555 5:136963604-136963626 CAGGGGAAGCCCAGGGGTGAGGG + Intergenic
999151671 5:149430434-149430456 GAGGGCAGTCCTGGGGGTGGGGG + Intergenic
1010328170 6:74588654-74588676 CAGTGCAGTCATAGGGGTGGTGG + Intergenic
1011104236 6:83761324-83761346 CAGGCCAATTCTAGGGGTCTGGG - Intergenic
1015578707 6:134701137-134701159 CAGGGCAGTCCTAGTGGTGGTGG - Intergenic
1019119723 6:169793143-169793165 CTGGGCAAAGCTAGGGGAGCTGG + Intergenic
1020094603 7:5361504-5361526 CAGGGCCTGCCTCGGGGTGCTGG - Intronic
1026174611 7:67985440-67985462 CATGGAAATGCTAGAGGTGCAGG + Intergenic
1026905733 7:74061811-74061833 CAGGGCAAGCTTAGGGATGGTGG - Intronic
1027826201 7:83119242-83119264 CAGTGCAATCCTAGCTGTGGTGG + Intronic
1028532001 7:91848626-91848648 CAGAACAATCCCAGGGCTGCTGG - Intronic
1029797194 7:102908814-102908836 CAGTGCAATCATAGTGGTGGAGG - Intronic
1030807716 7:113937274-113937296 CTGAGCAATCCTTGGTGTGCTGG - Intronic
1032074296 7:128829342-128829364 CAGGGCAAGCCAAAGGCTGCAGG - Intergenic
1033416052 7:141162110-141162132 ACGGGGAATCCTAGGGGAGCTGG - Intronic
1034018999 7:147619908-147619930 CAGCACAATCCTAGTGGTGGTGG + Intronic
1036797698 8:11768328-11768350 CAGGGGCATCCTGGGGGTGGGGG + Intergenic
1039588447 8:38727099-38727121 CAGGCCTATCCCTGGGGTGCGGG + Intergenic
1044280710 8:90352213-90352235 CAGTACAAACCTAGGGGTGATGG + Intergenic
1045265722 8:100617228-100617250 CAGGTCATACCTAGGTGTGCAGG - Intronic
1047255741 8:123212260-123212282 CAGGGAGACCCCAGGGGTGCAGG - Intergenic
1048373527 8:133801548-133801570 CAGGGCAGGCCTAGAGGGGCTGG - Intergenic
1048500556 8:134970951-134970973 AAGGGCAGTTTTAGGGGTGCTGG + Intergenic
1050005772 9:1128830-1128852 TAGGGAAATCCTAGGGATGGTGG - Intergenic
1050429982 9:5552483-5552505 CAGGGCTATCCCAGTGCTGCAGG - Intronic
1053123013 9:35560303-35560325 CAGGGCAGCCCAAGGGGAGCGGG + Exonic
1054255222 9:62804463-62804485 CAGGGCAGTCATAGTGGTGGTGG - Intergenic
1054336087 9:63811148-63811170 CAGGGCAGTCATAGTGGTGGTGG + Intergenic
1056795249 9:89654786-89654808 CAGGGCAAGGCAAGGGGAGCAGG - Intergenic
1061450751 9:130665887-130665909 CAGGGGAACCCTCGGGGAGCTGG + Intronic
1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG + Exonic
1203372356 Un_KI270442v1:320375-320397 CAGGGCAGTCATAGTGGTGGTGG + Intergenic
1203376016 Un_KI270442v1:378562-378584 CAGGGCAGTCATAGTGGTGGTGG + Intergenic
1185610684 X:1392329-1392351 CCCGGCATACCTAGGGGTGCGGG - Exonic
1189733432 X:44045668-44045690 CAGAACAACCCTAGGGCTGCTGG - Intergenic
1190938528 X:55018267-55018289 CTGGGCAATCCTGGTGGGGCAGG + Intronic
1191943654 X:66505464-66505486 CAGTGCAATCCTAGAGGTGCTGG + Intergenic
1192958684 X:76103591-76103613 CAGAGCAGTCCTAGTGGTGGTGG - Intergenic
1194787521 X:98105724-98105746 CAGCATAATCCTAGGGGTGGTGG - Intergenic
1195199456 X:102533425-102533447 CAGCACAATCCTAGTGGTGGTGG + Intergenic
1195782925 X:108484717-108484739 CAGCACAATCCCAGGGGTGGTGG - Intronic
1195821073 X:108946033-108946055 CAGTGCAGTCCTAGTGGTGGTGG - Intergenic
1195971403 X:110477703-110477725 CAGTGCAGTCCTAGTGGTGGTGG - Intergenic
1196096634 X:111808045-111808067 CAGGGAAGTCCTAGTGGTGGTGG - Intronic
1198004171 X:132475056-132475078 CTGGCCACTCCTAGGGGTGAGGG + Intronic
1199050685 X:143233008-143233030 CAGGGCAGTCCTAGTGGTGGTGG + Intergenic
1201066014 Y:10095020-10095042 CAGGGCAGTCATAGTGGTGGTGG - Intergenic