ID: 1169913539

View in Genome Browser
Species Human (GRCh38)
Location 20:10666474-10666496
Sequence CATCCCAGGAGGGCTTGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 255}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169913531_1169913539 -2 Left 1169913531 20:10666453-10666475 CCCAGTAGAGGCGGAGTCCTCCA 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1169913539 20:10666474-10666496 CATCCCAGGAGGGCTTGGAAAGG 0: 1
1: 0
2: 2
3: 36
4: 255
1169913526_1169913539 15 Left 1169913526 20:10666436-10666458 CCACTGCAACTCTGACCCCCAGT 0: 1
1: 0
2: 2
3: 31
4: 300
Right 1169913539 20:10666474-10666496 CATCCCAGGAGGGCTTGGAAAGG 0: 1
1: 0
2: 2
3: 36
4: 255
1169913532_1169913539 -3 Left 1169913532 20:10666454-10666476 CCAGTAGAGGCGGAGTCCTCCAT 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1169913539 20:10666474-10666496 CATCCCAGGAGGGCTTGGAAAGG 0: 1
1: 0
2: 2
3: 36
4: 255
1169913530_1169913539 -1 Left 1169913530 20:10666452-10666474 CCCCAGTAGAGGCGGAGTCCTCC 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1169913539 20:10666474-10666496 CATCCCAGGAGGGCTTGGAAAGG 0: 1
1: 0
2: 2
3: 36
4: 255
1169913529_1169913539 0 Left 1169913529 20:10666451-10666473 CCCCCAGTAGAGGCGGAGTCCTC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1169913539 20:10666474-10666496 CATCCCAGGAGGGCTTGGAAAGG 0: 1
1: 0
2: 2
3: 36
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169913539 Original CRISPR CATCCCAGGAGGGCTTGGAA AGG Intronic
901013776 1:6216034-6216056 CTTCCCAGGAAGGACTGGAAAGG - Intronic
901027282 1:6285316-6285338 CCGGCCAGCAGGGCTTGGAAGGG - Intronic
901119760 1:6881581-6881603 CAGCCCCGCAGGGCTTGGCACGG + Intronic
903326872 1:22573862-22573884 ACACCCAGGAGGGCTGGGAAGGG + Intronic
903446734 1:23427110-23427132 CAACCCAGAAGGGCTTGGCTGGG - Intergenic
904298433 1:29538885-29538907 CATCCCATGAGGACAAGGAAGGG - Intergenic
904972049 1:34426916-34426938 CATCCCAGGAGGATCTGGGAAGG + Intergenic
905402929 1:37716407-37716429 CTTCCCAGGAGGGGTGGGGAAGG + Exonic
905445952 1:38028642-38028664 GATCCCAGGAGGTCTGGGACAGG + Intergenic
905774494 1:40659917-40659939 CATTCCAAGAAGGCTTGGAAGGG + Intronic
906316042 1:44786919-44786941 CTTCCCAGGAGGGTGGGGAAGGG + Intronic
907746664 1:57220352-57220374 ATTCCCAGGAGGGCTTGGTGGGG + Intronic
910674281 1:89801187-89801209 CATCACAGCAGGGCTGGGCATGG - Intronic
911098629 1:94076545-94076567 AATCCCAAGAGGTCATGGAATGG + Intronic
912527858 1:110298040-110298062 CAGTCCAGCAGAGCTTGGAAGGG - Intergenic
915002786 1:152608814-152608836 CATCTCCAGGGGGCTTGGAATGG - Intergenic
915832587 1:159145132-159145154 CCTCCCAGGAAGGCTGGAAAAGG + Intronic
915849560 1:159306667-159306689 CAGCTTAGGAGGGCTGGGAAAGG + Intronic
916421926 1:164645600-164645622 CATGGCAGGAGGACTTGGGATGG + Intronic
918251628 1:182708318-182708340 CCTCCCAGGAAGCCATGGAAAGG + Intergenic
919794594 1:201313631-201313653 CATCCCAGGAGCCCTTTGCAGGG - Intronic
920234395 1:204493418-204493440 CATCCCAGGCATGATTGGAAGGG + Intronic
922085336 1:222341504-222341526 CAGCCCAGTTGGGGTTGGAAAGG + Intergenic
922162681 1:223089928-223089950 CATCCCAGGAATGTTTGTAAAGG - Intergenic
922744183 1:228035118-228035140 AATCCCAGGAGGGCTTCCCAGGG + Intronic
922977767 1:229799427-229799449 CCTCCCAGGAGGCCTTGGAATGG + Intergenic
924050774 1:240078030-240078052 CAGGCCTGGAGGCCTTGGAAAGG + Intronic
1063079448 10:2751588-2751610 TATCCCAGGATGGCTGGAAAAGG + Intergenic
1065916654 10:30358803-30358825 CCACCCAGGCAGGCTTGGAAAGG - Intronic
1067832220 10:49616767-49616789 GATCCCAGAAGGGCCTGGAGGGG + Intronic
1068525123 10:58119975-58119997 CAACCCAGGACGGCTTCGAATGG + Intergenic
1068637666 10:59365176-59365198 AATTCCAGGAGGGTTTGAAAAGG + Intergenic
1070750368 10:78960597-78960619 CATCCCAAAAGTGCCTGGAAGGG - Intergenic
1071518487 10:86314728-86314750 CATCTGAGGAGTGCTGGGAAAGG - Intronic
1072074605 10:91957272-91957294 CCTCCCAGGAGGGATTAAAAAGG - Exonic
1072806932 10:98429705-98429727 TCTCCCAGGAGGGATGGGAAAGG + Intronic
1073487357 10:103828037-103828059 CATCCCTGCAGGGCCTGGCACGG + Intronic
1075667052 10:124239013-124239035 CCTCCCAGCAGGGCTTGTGAAGG + Intergenic
1076667167 10:132099981-132100003 GATCACAGGAGGGCTGGGACCGG - Intergenic
1077303147 11:1856300-1856322 CAGGCCAGGAGGGCCTGGCATGG - Intronic
1078161501 11:8843639-8843661 TATGAGAGGAGGGCTTGGAAAGG - Intronic
1078267233 11:9764383-9764405 CAAACCAGGAGGGCTTGCCAGGG - Intergenic
1079344612 11:19641130-19641152 CCTCCCAGGTGGGCATGGGATGG - Intronic
1080335147 11:31186777-31186799 CATCTCAGAATGGCATGGAAGGG - Intronic
1080623686 11:34009073-34009095 TGTCCCAGGATGGCTTTGAATGG - Intergenic
1081196736 11:40170344-40170366 CATCCAAGGAGGTCCTGTAAAGG + Intronic
1081563086 11:44237108-44237130 CATCCCAGTAGTGCTTGTCAGGG + Intronic
1081620909 11:44618751-44618773 CAACCCAGGAGGACCTGGGATGG - Intronic
1081775239 11:45671752-45671774 CATCCCAGGAGGGGAGAGAAGGG + Intergenic
1082803539 11:57431989-57432011 CCTCCCAGGAAGGCTGGGTAGGG - Intergenic
1082847248 11:57736407-57736429 CAGCCCAGGATGGCTTTGAATGG - Intronic
1083815052 11:65128034-65128056 CATACAAGTAGGGCTTGGAGGGG + Exonic
1084443985 11:69192849-69192871 AAGCCCAGGAGGGCCTGCAAAGG - Intergenic
1084876110 11:72135202-72135224 CTTCCCAGGTGGGCTGAGAATGG + Intronic
1085350905 11:75797420-75797442 GACCCCAGGAAGGCATGGAAGGG + Intronic
1085511652 11:77091222-77091244 CATCCCAGCAGGGCTGTGTAGGG - Intronic
1088104916 11:106195870-106195892 CATACCAGCAGGGCATGGGACGG + Intergenic
1088581897 11:111324751-111324773 CATCCCAGGAGGGCTGGGTGAGG + Intergenic
1089135367 11:116244974-116244996 CAGGCCAGGAGAGCCTGGAAGGG + Intergenic
1089465433 11:118682190-118682212 CATCACAAGAGGGCTGGGCATGG - Intergenic
1089631496 11:119787272-119787294 CCTCCCAGGAGGGCTGGGAGCGG - Intergenic
1091045045 11:132317885-132317907 TCCCCCAGGAGGGCTGGGAAGGG + Intronic
1094659340 12:32451648-32451670 AATCCCAGGAGGGATTTGGAAGG + Intronic
1094871214 12:34600211-34600233 AATGCCAGGAAGGCTTGAAATGG + Intergenic
1096111560 12:49031929-49031951 CAGCCCAGGAGGCCCTGGAGGGG + Exonic
1097130583 12:56808193-56808215 CATCTCAGGAGAGCCTGCAAAGG - Intergenic
1100390956 12:94146517-94146539 CATTCCAGGAGGGCAGGGAGTGG + Intergenic
1101800102 12:108014287-108014309 CATCCCCCGAGGGCCTGGAAGGG - Intergenic
1103118754 12:118362404-118362426 CACCCCAGGATGGCTTTGAATGG - Intronic
1104947270 12:132421665-132421687 CATCGCAGAAGGGCATGGAGCGG + Intergenic
1105833134 13:24183531-24183553 CAGCCCAAGATGGCTTTGAATGG + Intronic
1107967335 13:45609212-45609234 CGGCCCAGGAGGGCTTTCAAAGG - Intronic
1108021211 13:46129511-46129533 CATCCCTGAAGGGATAGGAAGGG - Intronic
1108795312 13:54023527-54023549 CATCCCAGAGAGGTTTGGAACGG - Intergenic
1109372201 13:61437372-61437394 CATCTCAGAAGGGCTGAGAAAGG + Intergenic
1111628617 13:90821114-90821136 CATCCCAGGAGGACATGAAAAGG - Intergenic
1113122463 13:106938811-106938833 ATACCCAGGAAGGCTTGGAAAGG + Intergenic
1113421783 13:110176656-110176678 GACCCCAGGAGTGCCTGGAAAGG - Exonic
1113614084 13:111668948-111668970 CATCCCCGGAGAACTGGGAAGGG + Intronic
1113619551 13:111753862-111753884 CATCCCCGGAGAACTGGGAAGGG + Intergenic
1113837540 13:113338204-113338226 CATCCCAACAAGGCATGGAAAGG - Intronic
1114533507 14:23409508-23409530 AAGCCCTGGAGGGCTTGGAAAGG - Intergenic
1117932605 14:60859406-60859428 AATTCCATGAGGACTTGGAAAGG - Intronic
1118298034 14:64588337-64588359 CATCCCAGGTGGGGCTGGAAGGG + Intronic
1118319117 14:64743043-64743065 CAGCCGAGGAGGGCTTGGGAGGG - Exonic
1118582745 14:67319683-67319705 CAGCCCAGGACGGCTTTGAATGG - Intronic
1120825949 14:88955594-88955616 CATCCCAGCAGGACTAGAAAGGG + Intergenic
1121582427 14:95040866-95040888 CATCACAGAAGGGGTTGGCAGGG + Intergenic
1121638797 14:95471723-95471745 CAGTCCAGGAGTGCTTGGCAAGG + Intronic
1122050304 14:99054693-99054715 CCACCCAGGAGGGCTTGCAATGG + Intergenic
1122087006 14:99314771-99314793 CATGCTAGGTGGGCTTGGAGAGG - Intergenic
1122258537 14:100498763-100498785 CTGGCCAGCAGGGCTTGGAATGG - Intronic
1122598184 14:102907822-102907844 AATCCCAGGAGAGCGGGGAAAGG - Exonic
1122775319 14:104114423-104114445 CATCCCACGAGGGTTTGGAGGGG - Exonic
1123838694 15:24224297-24224319 CATCCCAGCCTGGCTTGGCAAGG - Intergenic
1124384454 15:29194999-29195021 CCTCCCAGGAGGGCTGTGAAAGG + Intronic
1124483758 15:30098775-30098797 CCGCCCAGGCAGGCTTGGAAAGG + Intergenic
1124490208 15:30150818-30150840 CCGCCCAGGCAGGCTTGGAAAGG + Intergenic
1124519821 15:30398451-30398473 CCGCCCAGGCAGGCTTGGAAAGG - Intergenic
1124538833 15:30567771-30567793 CCGCCCAGGCAGGCTTGGAAAGG + Intergenic
1124753324 15:32387511-32387533 CCGCCCAGGCAGGCTTGGAAAGG - Intergenic
1124759817 15:32439800-32439822 CCGCCCAGGCAGGCTTGGAAAGG - Intergenic
1124975067 15:34523211-34523233 CCGCCCAGGCAGGCTTGGAAAGG - Intergenic
1127966531 15:63926782-63926804 CATCAAGGGAGTGCTTGGAATGG - Intronic
1128717669 15:69920475-69920497 CACCCCAGGAGGCCTTAGAAGGG - Intergenic
1129210490 15:74065257-74065279 CCGCCCAGGCAGGCTTGGAAAGG - Intergenic
1129403522 15:75300117-75300139 CCGCCCAGGCAGGCTTGGAAAGG + Intergenic
1129727690 15:77909891-77909913 CCGCCCAGGCAGGCTTGGAAAGG - Intergenic
1129760431 15:78126087-78126109 CAGCCCAGGAGGGCTGGGAATGG + Intronic
1129840204 15:78739083-78739105 CCGCCCAGGCAGGCTTGGAAAGG + Intergenic
1130258708 15:82337909-82337931 CCACCCAGGCAGGCTTGGAAAGG - Intergenic
1130269977 15:82441175-82441197 CCACCCAGGCAGGCTTGGAAAGG + Intergenic
1130462312 15:84168488-84168510 CCGCCCAGGCAGGCTTGGAAAGG + Intergenic
1130473931 15:84247413-84247435 CCGCCCAGGCAGGCTTGGAAAGG + Intergenic
1130481345 15:84361481-84361503 CCGCCCAGGCAGGCTTGGAAAGG + Intergenic
1130490361 15:84426297-84426319 CCACCCAGGCAGGCTTGGAAAGG - Intergenic
1130501952 15:84505055-84505077 CCGCCCAGGCAGGCTTGGAAAGG - Intergenic
1130596215 15:85252050-85252072 CCGCCCAGGCAGGCTTGGAAAGG + Intergenic
1131345905 15:91647841-91647863 CATCCCAGGAGCCCTAGCAAAGG - Intergenic
1132204604 15:99977813-99977835 TCTCCCAGGAGCCCTTGGAATGG + Intronic
1132508412 16:324312-324334 CCTCCCAGGAGGGCTCAGAAAGG - Intronic
1133015562 16:2937981-2938003 CATCCCCAGAGCCCTTGGAAAGG + Intronic
1135712144 16:24726963-24726985 CAGCCCAGGAGGGCTCAGATGGG + Intergenic
1135725433 16:24850498-24850520 CAGCCCAGGAGTGGTAGGAAAGG + Intronic
1136173406 16:28502073-28502095 CCTCCCAGCAGGGCATGGAAGGG + Exonic
1137584254 16:49654531-49654553 AAGCCCGGGAGGGCTGGGAATGG + Intronic
1137598013 16:49737729-49737751 CTTCCCAGCAGGGCTTCGCAAGG + Intronic
1140523525 16:75602821-75602843 AATCAAAGGAGGGCCTGGAATGG + Intronic
1141774225 16:86111495-86111517 AAGCCCAGGAGGGCTTAGGAAGG + Intergenic
1141856435 16:86684541-86684563 CCTCCCAGGTGGGCTAGGAGAGG - Intergenic
1141950987 16:87339258-87339280 CATCCCAGGAGGTCTGGACATGG - Intronic
1142354632 16:89596744-89596766 GATCCCAGGAGGACTGGGAGTGG - Exonic
1143125108 17:4636862-4636884 CAGCCCAGGAGGGATTGGGGAGG - Intronic
1143539623 17:7561457-7561479 CAGCCCGGAAGGGCTTGGAATGG - Exonic
1145794721 17:27649063-27649085 GATCCCAGGCAGGGTTGGAAAGG - Exonic
1147442368 17:40454965-40454987 CATCCCAGGATGGCATGAAAAGG + Intronic
1148225764 17:45896849-45896871 CATCACAGGAGGGCGAGGCATGG - Intronic
1148674128 17:49435206-49435228 TGTCCCAGGTCGGCTTGGAAGGG - Intronic
1149866176 17:60152199-60152221 ACTCCCAAGAGGGCTTGGGAAGG - Intronic
1150280817 17:63928871-63928893 CCTCCCAGCAGAGCTTGGGAAGG - Exonic
1150484717 17:65535908-65535930 GCTCCCAGGGGGGCTTAGAATGG - Intronic
1150616697 17:66777898-66777920 GATCCCAGGAAGGCTTGGAGAGG - Intronic
1152292878 17:79450437-79450459 CATCCCAGGATGGCTCCGATGGG - Intronic
1153617939 18:6951577-6951599 AGTCACAGGAGGGCTTTGAAAGG + Intronic
1154009937 18:10565648-10565670 CATGGCAGGAGGGGCTGGAAGGG - Intergenic
1155549700 18:26952159-26952181 CATAGCAGGAGGGCTAGGGATGG + Intronic
1156464656 18:37341210-37341232 CCTCCCAGGGGGCCTTGGAGGGG + Intronic
1156499627 18:37549306-37549328 CATAGCAAGAGGGCTTGGAAGGG + Intronic
1157898573 18:51491684-51491706 CCTCCCAGAAGTGCTTGGAAAGG + Intergenic
1160744750 19:705593-705615 ACTCCCCGGAGGGCTGGGAATGG - Intergenic
1160990339 19:1857785-1857807 CATCCCAGGAGAGCCAGGAAAGG + Intronic
1163132569 19:15284631-15284653 CCTCCCAGCAGTGCATGGAATGG - Intronic
1163705189 19:18808293-18808315 CCTCCAAGGAGGGCATGGCAGGG - Intergenic
1164118193 19:22242222-22242244 CATCACATGAGTGCTGGGAAAGG + Intergenic
1164145600 19:22510701-22510723 CATCCCTGAAGGCCTTGGCATGG - Intronic
1164201214 19:23020406-23020428 CATCACATGAGTGCTGGGAAAGG + Intergenic
1165728135 19:38126396-38126418 CAGCCCAAGAGGGCTTTGAATGG + Intronic
1166054051 19:40278053-40278075 CATCCCAAGCAGGCATGGAATGG + Intronic
1166421910 19:42643101-42643123 CATTCTATGAGGGCTTTGAATGG - Intronic
1168711087 19:58500333-58500355 CATCCCTGTAGGGCTAGGTATGG - Exonic
925059685 2:881306-881328 CATCCCAGGAGAGAGTGGAAGGG + Intergenic
925734911 2:6955494-6955516 GATGGCAGGAGGGCCTGGAATGG - Intronic
926519541 2:13894169-13894191 CAGTCCAGGAGGGAATGGAAAGG - Intergenic
927873807 2:26640983-26641005 CAGCCCAGGACAGCTTTGAATGG + Intronic
927930516 2:27040604-27040626 CATCCCAGGGTGGCCAGGAATGG - Intronic
929376379 2:41291118-41291140 CATGCCAGGAGGCTTTTGAATGG - Intergenic
931815608 2:65897754-65897776 CAACACAGGTGGACTTGGAAAGG - Intergenic
932189662 2:69730209-69730231 AAACCCAGGAGGGCTGGGCATGG + Intronic
933307635 2:80621691-80621713 AATCCCAGGTGGTTTTGGAAGGG + Intronic
933892616 2:86785669-86785691 CATCGCGGTAGGGCGTGGAAAGG - Exonic
933990333 2:87629069-87629091 GGTCCCAGGAGGACTTGGCATGG + Intergenic
934917266 2:98310310-98310332 GACCCCAGGAGGGCATGGAGTGG + Intronic
935939870 2:108227085-108227107 GATCCCAGGAGGTCTTTGGATGG - Intergenic
936095589 2:109528437-109528459 CTTCCCAGGAGGGCAGGGCATGG - Intergenic
936303513 2:111321755-111321777 GGTCCCAGGAGGACTTGGCATGG - Intergenic
936585781 2:113756568-113756590 CGGCCCAGGAGGGCGTGGAGCGG + Exonic
937881535 2:126870099-126870121 CATCACAGGAAGGCTGGGCAGGG + Intergenic
937955986 2:127422101-127422123 CATCCCTGGATGCCTTGGAAGGG - Intronic
938090184 2:128426184-128426206 CCTCCCAGGGAGGCTGGGAAGGG - Intergenic
938770450 2:134496705-134496727 CAGACAAGGAGAGCTTGGAAGGG + Intronic
942451608 2:176111866-176111888 CATCCCAGGAGGTCTGAGAGGGG - Intronic
942593961 2:177574652-177574674 CATCCAAGCAGGGCCTGGGAAGG - Intergenic
944897274 2:204177952-204177974 GATGCAAGGAGGGCTTAGAAAGG - Intergenic
945000912 2:205349387-205349409 CATGCCAGGAGAGCTTGGAGAGG - Intronic
945041337 2:205745946-205745968 CATCCCACGAGGCCCTGGGAGGG + Intronic
947604813 2:231479094-231479116 CATTTCAGGTGGGCCTGGAAGGG + Intronic
948423027 2:237872184-237872206 CAGCCAAGGAGGGCCTGGCACGG + Intronic
1169913539 20:10666474-10666496 CATCCCAGGAGGGCTTGGAAAGG + Intronic
1170986958 20:21267247-21267269 CATACCAGAAGGGGCTGGAATGG + Intergenic
1171323903 20:24273705-24273727 TATACCAGGAGGGCATGAAAAGG - Intergenic
1171439416 20:25148460-25148482 TCTCCCAGGTGGGCTTGGAGGGG - Intergenic
1173575721 20:44112039-44112061 GGTCCCAGCAGGGCTTGAAACGG + Exonic
1175383155 20:58577408-58577430 CATGGCAGGAGCGCTTGGAGGGG + Intergenic
1176910131 21:14555081-14555103 CAGCCCAGCAGGGCATGGAAAGG - Intronic
1177996903 21:28111529-28111551 GATCCCAGCTGAGCTTGGAAGGG - Intergenic
1178898758 21:36582696-36582718 CATTACAGAAGGGCTGGGAAAGG - Intergenic
1179134789 21:38669939-38669961 CATCCCAGAAGGGCTGAGGATGG + Intergenic
1179995909 21:44973877-44973899 CCTCCCAGGAAGGCTTCCAAGGG + Intronic
1180094596 21:45550108-45550130 CAGCCCAGGAGGGGCTGGGATGG - Intergenic
1180179357 21:46111164-46111186 CAGCCCTGGAGGACATGGAAGGG + Intronic
1181459643 22:23078572-23078594 CCTCCCAGGATGGTGTGGAATGG + Intronic
1182447527 22:30398160-30398182 CATCCCAGGAAGGCTGGACAGGG + Intronic
1182648075 22:31826612-31826634 CACCCCGGGAGGGCATGGGAAGG - Intronic
1183720684 22:39559858-39559880 TTTCTCAGGAGGTCTTGGAATGG - Intergenic
1183745971 22:39691857-39691879 CATCCCAGGAGGACAGGGCAGGG - Intergenic
1185063638 22:48620118-48620140 CATCCCAGAAGGGTGTGGACTGG - Intronic
1185355020 22:50363199-50363221 CAGCACAAGAGGGCATGGAAGGG - Intronic
1185369804 22:50455793-50455815 CAGTCCTAGAGGGCTTGGAAGGG - Intronic
952029812 3:29128165-29128187 CAAGACAGGAGGGCTTTGAAGGG - Intergenic
954098380 3:48349700-48349722 TAGCCCAGGATTGCTTGGAATGG + Intergenic
954456779 3:50603914-50603936 CTGCCCAGGAGGGGTGGGAAGGG - Intergenic
957945186 3:87054558-87054580 ATGCCCAGGAGGGCTTAGAAGGG - Intergenic
959087565 3:101867874-101867896 AATCCCAGGAGGTCAGGGAAAGG - Intergenic
959275443 3:104271663-104271685 GAGCCAAGGAAGGCTTGGAAGGG - Intergenic
959981714 3:112524945-112524967 CAGCCCAGGAGAGGTTGGAGAGG + Intergenic
960560945 3:119083436-119083458 ATTCCCAGGAGGGATAGGAAAGG - Intronic
961085397 3:124063094-124063116 CCTTCCAGGAGAGCTTGGAGAGG + Intergenic
962839555 3:139221538-139221560 GGTCCCTGGGGGGCTTGGAAAGG + Intronic
962960663 3:140308435-140308457 AATTCCAGGAGGGATTGCAAAGG - Intronic
965284763 3:166804994-166805016 CCTCCCAGGAGCTCCTGGAAGGG + Intergenic
969629221 4:8325802-8325824 GATCCCAGGAAGCCTTGGTAGGG - Intergenic
969927336 4:10597250-10597272 CACCCCAGGAAGGCTTGGCCAGG + Intronic
971034209 4:22675439-22675461 AATCCCAGGAGGGCAAGGACAGG + Intergenic
972419558 4:38873844-38873866 CATCTCAGGAGGGAGAGGAAGGG + Intronic
980104834 4:128577781-128577803 CGGCCCAGGATGGCTTTGAATGG - Intergenic
981598109 4:146449965-146449987 CATCAAAGGAGGGGTGGGAATGG + Intronic
982359155 4:154500158-154500180 AATCCCAGGGGGCCTTAGAAGGG + Intergenic
982435845 4:155383146-155383168 CCACCCAGGAGAGCATGGAAAGG - Intergenic
983347801 4:166548858-166548880 CAACAGAGGAAGGCTTGGAAGGG - Intergenic
984918830 4:184746361-184746383 CATCCCAGGAGGGCAGGCATGGG + Intergenic
986431304 5:7683655-7683677 CCTCCCAGGGGGGCATGGGAGGG + Intronic
990012438 5:51016004-51016026 CACCCCAGGAGAGCTTTGGATGG + Intergenic
990051796 5:51511263-51511285 CAGCCCAGTATGGCTTTGAATGG + Intergenic
990711246 5:58582863-58582885 TAACCCAGGAGCGTTTGGAAAGG + Intronic
990998283 5:61755609-61755631 CCTCCAAGGAATGCTTGGAAAGG + Intergenic
992654877 5:78899130-78899152 CAGGCCAGGAGGGAGTGGAATGG - Intronic
992894590 5:81235147-81235169 CATCACAGGAGGCCTAGGAAAGG + Intronic
993245862 5:85452258-85452280 GCTCCCTGGAGGGCTGGGAAGGG + Intergenic
996088550 5:119328066-119328088 CAACCCAGCTGGGCTTGAAATGG + Intronic
996365916 5:122701386-122701408 CAGGTCAGGATGGCTTGGAAAGG + Intergenic
996620579 5:125497061-125497083 CACCCCAGGAGCATTTGGAAAGG - Intergenic
997406876 5:133656146-133656168 CATCTCAGGAGGCCCTGGTAGGG + Intergenic
999203581 5:149833066-149833088 CAGCCCAGGAGGCTTTGGAGTGG - Exonic
1000963400 5:167627014-167627036 AATGACATGAGGGCTTGGAAAGG + Intronic
1001845655 5:174918429-174918451 CTGCCCAGGCAGGCTTGGAAAGG - Intergenic
1002047390 5:176549650-176549672 CATCCCTTGAGGACTTGGATGGG - Intronic
1002567482 5:180119968-180119990 CAGCCCAGGATGGCTGGGGAAGG - Intronic
1006496126 6:34425001-34425023 CATCCCGGGATGGGATGGAATGG - Intronic
1006945951 6:37784622-37784644 CATCCCAGGAGGAGAGGGAAAGG + Intergenic
1007546534 6:42698724-42698746 CAGCCCAGGATGGCTGGAAAGGG - Intronic
1010207882 6:73339183-73339205 CATCGATGGAGGGCTTGCAAAGG + Intergenic
1012991974 6:105935287-105935309 CATCCCAGGTGCCCTTGGCAGGG - Intergenic
1014295673 6:119614264-119614286 CATCCCAGTGGGGGTGGGAAAGG + Intergenic
1018315636 6:162553935-162553957 CATGGCAGGAGGGCTGGGGAAGG + Intronic
1018372383 6:163179939-163179961 CCTCCCAGGAGGGCTCGGCTGGG - Intronic
1019271861 7:153926-153948 CATCCCCAGAGGGCTTGGTAAGG + Intergenic
1020077994 7:5271121-5271143 CAGCCCAGGAAGGCTTCCAAGGG + Intergenic
1023990788 7:45127120-45127142 CTTGCCTGGAGGGCTTGGACAGG + Intergenic
1025143400 7:56484076-56484098 CAGCCCAGGAGGGTTGGGCAGGG + Intergenic
1025200900 7:56961053-56961075 CAGCCCAGGAAGGCTTCCAAGGG - Intergenic
1025671043 7:63615879-63615901 CAGCCCAGGAAGGCTTCCAAGGG + Intergenic
1025981303 7:66409121-66409143 CAAACCAGGAGGGCTTCAAAAGG + Intronic
1027206167 7:76101293-76101315 CAAACCAGGAGGGCTTCGAAAGG + Intergenic
1028254977 7:88584370-88584392 CAGTCCAGGATGGATTGGAAGGG - Intergenic
1029987046 7:104931730-104931752 CTTCCCAGCAGGGCTCAGAAGGG + Intergenic
1031931873 7:127693915-127693937 CATCCCAGGAGTGATAGGATGGG + Intronic
1033018318 7:137695173-137695195 AATACCTGGAGGGCTTTGAATGG - Intronic
1034531532 7:151698911-151698933 CATCTCAGGGTGGCTTGGAGTGG - Intronic
1035285923 7:157807232-157807254 CATCTCAAGAGGGCACGGAAAGG - Intronic
1036196949 8:6726818-6726840 CATCCCAGCAGGATTTGGGAAGG + Intronic
1037708112 8:21332823-21332845 ATCCCCAGGAGTGCTTGGAAAGG + Intergenic
1037834916 8:22210029-22210051 CAGCCCACCAGGGCCTGGAATGG + Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1038326440 8:26576571-26576593 CATCCCAGCATGGCTTGGACAGG + Intronic
1039065584 8:33604790-33604812 CAGCCCAGGAGGGATGGGCATGG - Intergenic
1039455730 8:37704831-37704853 CATCCCAGGAAAACCTGGAAAGG - Intergenic
1043337681 8:79197058-79197080 CAAGCCAGGAGGGCTTGAGATGG + Intergenic
1046016797 8:108615214-108615236 ATTCCAAGGATGGCTTGGAAGGG + Intronic
1047226820 8:122962001-122962023 CATCTCAGGAGGGGTTGGGCTGG + Intronic
1047351477 8:124078700-124078722 CATCCCAGGTGGGATGGGATGGG + Intronic
1048499311 8:134961219-134961241 CATCTCAGTGGGGCTTGCAATGG + Intergenic
1049742820 8:144249178-144249200 CACCCGAGGAGGGCTGGGCAGGG - Intronic
1057215646 9:93227012-93227034 CCTCAGAGGAGGGCTTGGCAGGG - Intronic
1059069194 9:111117652-111117674 CATCCCAGCAGGGTTTGCAAGGG + Intergenic
1061320104 9:129823435-129823457 CATCCCAGGAGGGCCGGGCCTGG - Intronic
1188082680 X:25863380-25863402 CATTCCATGTGTGCTTGGAAAGG - Intergenic
1197679043 X:129362804-129362826 CATTCCAGCAGGGCATGAAAGGG + Intergenic
1198987549 X:142473306-142473328 CATCCCAGGAGGTAATGGTAGGG - Intergenic
1200327813 X:155260881-155260903 CAATCCAGGAGGGCTGGGAAGGG - Exonic
1202064960 Y:20929429-20929451 CAGGCCAGGAGGGGTTGGAATGG + Intergenic
1202367865 Y:24179265-24179287 CCACCCAGGCAGGCTTGGAAAGG + Intergenic
1202376975 Y:24246643-24246665 CCACCCAGGCAGGCTTGGAAAGG - Intergenic
1202493805 Y:25423478-25423500 CCACCCAGGCAGGCTTGGAAAGG + Intergenic
1202502918 Y:25490852-25490874 CCACCCAGGCAGGCTTGGAAAGG - Intergenic