ID: 1169913804

View in Genome Browser
Species Human (GRCh38)
Location 20:10668282-10668304
Sequence CCAATGTATCTTCCAACAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 83}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169913796_1169913804 19 Left 1169913796 20:10668240-10668262 CCATTTCCACCACCATTTTAGAA 0: 1
1: 0
2: 2
3: 37
4: 378
Right 1169913804 20:10668282-10668304 CCAATGTATCTTCCAACAGTTGG 0: 1
1: 0
2: 0
3: 10
4: 83
1169913797_1169913804 13 Left 1169913797 20:10668246-10668268 CCACCACCATTTTAGAATCACCA 0: 1
1: 0
2: 1
3: 13
4: 228
Right 1169913804 20:10668282-10668304 CCAATGTATCTTCCAACAGTTGG 0: 1
1: 0
2: 0
3: 10
4: 83
1169913795_1169913804 22 Left 1169913795 20:10668237-10668259 CCTCCATTTCCACCACCATTTTA 0: 1
1: 0
2: 5
3: 56
4: 461
Right 1169913804 20:10668282-10668304 CCAATGTATCTTCCAACAGTTGG 0: 1
1: 0
2: 0
3: 10
4: 83
1169913793_1169913804 26 Left 1169913793 20:10668233-10668255 CCCTCCTCCATTTCCACCACCAT 0: 1
1: 2
2: 3
3: 96
4: 808
Right 1169913804 20:10668282-10668304 CCAATGTATCTTCCAACAGTTGG 0: 1
1: 0
2: 0
3: 10
4: 83
1169913799_1169913804 7 Left 1169913799 20:10668252-10668274 CCATTTTAGAATCACCACTTTCC 0: 1
1: 0
2: 2
3: 34
4: 247
Right 1169913804 20:10668282-10668304 CCAATGTATCTTCCAACAGTTGG 0: 1
1: 0
2: 0
3: 10
4: 83
1169913794_1169913804 25 Left 1169913794 20:10668234-10668256 CCTCCTCCATTTCCACCACCATT 0: 1
1: 0
2: 11
3: 195
4: 1375
Right 1169913804 20:10668282-10668304 CCAATGTATCTTCCAACAGTTGG 0: 1
1: 0
2: 0
3: 10
4: 83
1169913800_1169913804 -7 Left 1169913800 20:10668266-10668288 CCACTTTCCATTCATCCCAATGT 0: 1
1: 2
2: 7
3: 20
4: 254
Right 1169913804 20:10668282-10668304 CCAATGTATCTTCCAACAGTTGG 0: 1
1: 0
2: 0
3: 10
4: 83
1169913798_1169913804 10 Left 1169913798 20:10668249-10668271 CCACCATTTTAGAATCACCACTT 0: 1
1: 0
2: 2
3: 24
4: 191
Right 1169913804 20:10668282-10668304 CCAATGTATCTTCCAACAGTTGG 0: 1
1: 0
2: 0
3: 10
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169913804 Original CRISPR CCAATGTATCTTCCAACAGT TGG Intronic
901213408 1:7539397-7539419 CCCAGGTTTCTTCCAAAAGTGGG + Intronic
902744700 1:18465855-18465877 TGAATGTATGTTCCACCAGTGGG - Intergenic
906118831 1:43373923-43373945 CCAATGTCTGATCCATCAGTGGG + Intergenic
923069410 1:230549094-230549116 CCAATGTGTCTTCCAAAAATAGG - Intergenic
923913801 1:238480943-238480965 GCAATCTATGTTGCAACAGTAGG + Intergenic
1068665793 10:59674541-59674563 CAAATTTATCATCCAATAGTTGG + Intronic
1071778516 10:88816209-88816231 GCAATGTATCTGCCTACAATTGG + Intronic
1088199871 11:107320801-107320823 CCAATGAATCTTTCGACAATGGG + Intergenic
1096196754 12:49653555-49653577 CCACTGGATCATCCACCAGTTGG - Intronic
1098225584 12:68319025-68319047 CCAATGTGTCTTCCACAAATAGG - Intronic
1101126992 12:101646133-101646155 CAACTCTATCTTCCAACAGTGGG + Intronic
1105823492 13:24100791-24100813 GAAATGCATCTTGCAACAGTGGG - Intronic
1109234528 13:59798750-59798772 CCAATTTCTCTTCCACCAGATGG - Intronic
1109889214 13:68585243-68585265 ACAAAGCATCTTCAAACAGTGGG + Intergenic
1111577355 13:90173196-90173218 CAAATGTATGTTAAAACAGTAGG - Intergenic
1111789994 13:92842618-92842640 GAAATGTATCTCCCAACAATGGG + Intronic
1111973090 13:94937756-94937778 CTAATGTGTCATCCATCAGTCGG + Intergenic
1112822186 13:103350507-103350529 CCAGTGGAACTTCCAAAAGTTGG + Intergenic
1117674021 14:58137993-58138015 TCATTGTATTTCCCAACAGTTGG + Exonic
1117849506 14:59952522-59952544 CCAATCTATTTTCTAACAGCTGG + Intronic
1129812382 15:78521133-78521155 CCATTGAAGCTTCCAGCAGTTGG + Intronic
1137693274 16:50444658-50444680 ACAATGTAGCTTCCAAAACTAGG + Intergenic
1138790186 16:59894885-59894907 GCTATGTCTCTTCCAACTGTGGG + Intergenic
1141150584 16:81562162-81562184 TCAATGTAACTTACAACGGTTGG - Intronic
1148436029 17:47686076-47686098 CTAATGGATCATCCAAAAGTTGG + Intergenic
1150613655 17:66752714-66752736 CCAAGGTATCTTCCAGCTATTGG + Intronic
1151195621 17:72429487-72429509 CCAATGAATCATGCAACACTTGG + Intergenic
1155135533 18:22987869-22987891 CCAATGTATCTACCTGCTGTTGG + Intronic
1157126237 18:44959080-44959102 GCCATTTATCTTCCCACAGTTGG + Intronic
1157518985 18:48332076-48332098 CCAATATATCCTTCTACAGTAGG + Intronic
1157988325 18:52465258-52465280 GCAATGTATTCTCCAAAAGTTGG + Intronic
1164573165 19:29388478-29388500 CAAGTGTATCTTCCAACGCTAGG + Intergenic
1164898712 19:31899762-31899784 CCATTTTGTCTTCCATCAGTTGG + Intergenic
1168069210 19:53940491-53940513 CCAAAGTTTCTTCTAACACTGGG + Intronic
930184366 2:48397269-48397291 CCATTGCCTCTTCCAACAGCTGG - Intergenic
935765339 2:106361180-106361202 CCAATATATCTGCTAAGAGTTGG + Intergenic
944229763 2:197380877-197380899 CCATTGAATCTTCCATCAGATGG + Intergenic
945807377 2:214506466-214506488 CCATAGTATCTTCAAACACTGGG - Intronic
1169913804 20:10668282-10668304 CCAATGTATCTTCCAACAGTTGG + Intronic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1172042649 20:32056857-32056879 CCACTGTATCTTCTAACACCTGG + Intronic
1184417852 22:44362558-44362580 CCAAAGTAGCTTACACCAGTTGG + Intergenic
1185035320 22:48473143-48473165 TCAATTTATGTTCCAAGAGTTGG + Intergenic
949499716 3:4668174-4668196 CCAATTTACCTACAAACAGTAGG + Intronic
951980610 3:28562229-28562251 TCAATGGATCTTTCAACAGTGGG + Intergenic
953140335 3:40223809-40223831 CCACTGTCTCCTCCAACAGAAGG - Intronic
953242058 3:41158482-41158504 ACAATTTATCTTCTAACAGAAGG + Intergenic
956260690 3:67337222-67337244 CCAATGTCTCTTGCAATATTGGG - Intergenic
958951830 3:100425223-100425245 CCAGTGTGTCTTCCCACCGTGGG + Intronic
959055021 3:101559138-101559160 CCAACGTCTCTTTCAAGAGTTGG - Intergenic
961056160 3:123790417-123790439 CCAATGTATCTCCCACAAGGTGG + Intronic
961188846 3:124940314-124940336 ACAATTTATCTTCCAAAAGTTGG + Intronic
962054257 3:131852061-131852083 CCCATGTCTCTTTCAAAAGTAGG - Intronic
963578967 3:147099995-147100017 CCACTGTATCTTCTAACTGCAGG + Intergenic
968141471 3:196261356-196261378 CCAATGTATCTTTTAAAATTTGG - Intronic
968214703 3:196879030-196879052 CCACTGTATCTTCCCACTATAGG + Intronic
970662022 4:18296017-18296039 ACAGTGCATCTTCCAACATTTGG + Intergenic
971065055 4:23022065-23022087 CTCATGTATCTTGCAACAGCAGG - Intergenic
972060947 4:34872488-34872510 CAAATGTAGTTTCCAACAGAGGG - Intergenic
972193968 4:36630229-36630251 CCAAAGTATATTCCACCAATGGG - Intergenic
978282476 4:107035277-107035299 CCATTGCATCTTGCAACATTCGG - Intronic
980346161 4:131622586-131622608 CTAATGTATCTTCCCCTAGTTGG - Intergenic
981182737 4:141764780-141764802 TCCATGTATCTTCCAACATTTGG - Intergenic
984640337 4:182157978-182158000 CCAATGTTTCTTTCAAAAATGGG - Intronic
990701434 5:58478993-58479015 CCACAGGATGTTCCAACAGTTGG + Intergenic
990820920 5:59839330-59839352 CCAAGTTATCTACCAACAGTTGG + Intronic
993242525 5:85408942-85408964 CCAAATTATCTTCTAATAGTGGG - Intergenic
996543845 5:124657134-124657156 CCATTGTATCTTCTAGAAGTGGG - Intronic
1001377316 5:171273541-171273563 TCAATGTATCTGGCAACACTGGG - Intronic
1003970279 6:11292504-11292526 CCAATGACTCTTCCACCAGCAGG + Intronic
1011690215 6:89859922-89859944 CAAAGGTATCTACCAACAGTTGG + Intronic
1011941087 6:92844307-92844329 TCAATCTATCTTCAAACAGATGG - Intergenic
1012005515 6:93708329-93708351 CCAAAGTATCTTCCAAGACAAGG - Intergenic
1017766694 6:157612630-157612652 CCGATGTCTCTGCCCACAGTTGG + Intronic
1022641494 7:32189506-32189528 CAAATGAATCATCCAACAGATGG - Intronic
1026285501 7:68959254-68959276 GTTTTGTATCTTCCAACAGTGGG + Intergenic
1028305900 7:89264124-89264146 CAAATGTAACTTTGAACAGTAGG - Intronic
1033957089 7:146863192-146863214 TAAATGTATCTCCCAATAGTAGG + Intronic
1041098066 8:54369088-54369110 CGTGTGTATTTTCCAACAGTAGG + Intergenic
1043044470 8:75303970-75303992 CCAAAGTATCCTTCATCAGTTGG - Intergenic
1045086630 8:98693659-98693681 GCAAGGAATCTTCCAACAGGTGG + Intronic
1046791094 8:118322726-118322748 TCAATGTCTCTTCCATCACTTGG - Intronic
1048586328 8:135777472-135777494 GCAATGTATCTTCACACAGCAGG + Intergenic
1048630276 8:136234808-136234830 CTAAGGTATCTTCCAACATTGGG - Intergenic
1050876733 9:10648617-10648639 CAAAAATATCTCCCAACAGTCGG + Intergenic
1051795562 9:20865392-20865414 GCCATTTACCTTCCAACAGTCGG - Intronic
1056036931 9:82616594-82616616 CAAAAGTATCTTCCAAGAGTTGG - Intergenic
1056989219 9:91394342-91394364 CCGATTTTTTTTCCAACAGTAGG - Intergenic
1059566073 9:115384385-115384407 CCTCTGTAGCTTCCAAAAGTTGG - Intronic
1190810663 X:53880464-53880486 CCACTGTCTCTTCCAGAAGTGGG + Intergenic
1192756764 X:74054861-74054883 GATATGTATGTTCCAACAGTGGG - Intergenic
1194124198 X:89993076-89993098 CCAATGTATTTTCCAAGCTTAGG - Intergenic
1195321856 X:103727341-103727363 CCAATGTGTCTGCAAACAGTGGG + Intronic
1200477089 Y:3650698-3650720 CCAATGTATTTTCCAAGCTTAGG - Intergenic