ID: 1169919590

View in Genome Browser
Species Human (GRCh38)
Location 20:10720450-10720472
Sequence TAGGTTAGAAAACCTGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169919590_1169919597 26 Left 1169919590 20:10720450-10720472 CCTCCAGCAGGTTTTCTAACCTA No data
Right 1169919597 20:10720499-10720521 AAAAATATTCTTTGGGCTACGGG No data
1169919590_1169919595 19 Left 1169919590 20:10720450-10720472 CCTCCAGCAGGTTTTCTAACCTA No data
Right 1169919595 20:10720492-10720514 GAAAAGGAAAAATATTCTTTGGG No data
1169919590_1169919593 3 Left 1169919590 20:10720450-10720472 CCTCCAGCAGGTTTTCTAACCTA No data
Right 1169919593 20:10720476-10720498 TGCAACTTTCTTGTGAGAAAAGG No data
1169919590_1169919594 18 Left 1169919590 20:10720450-10720472 CCTCCAGCAGGTTTTCTAACCTA No data
Right 1169919594 20:10720491-10720513 AGAAAAGGAAAAATATTCTTTGG No data
1169919590_1169919596 25 Left 1169919590 20:10720450-10720472 CCTCCAGCAGGTTTTCTAACCTA No data
Right 1169919596 20:10720498-10720520 GAAAAATATTCTTTGGGCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169919590 Original CRISPR TAGGTTAGAAAACCTGCTGG AGG (reversed) Intergenic
No off target data available for this crispr