ID: 1169919639

View in Genome Browser
Species Human (GRCh38)
Location 20:10721073-10721095
Sequence CAGCAAGAACAGATTTTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169919639_1169919640 -2 Left 1169919639 20:10721073-10721095 CCTTGTAAAATCTGTTCTTGCTG No data
Right 1169919640 20:10721094-10721116 TGTTAACCTCATTTGTATGAAGG No data
1169919639_1169919642 10 Left 1169919639 20:10721073-10721095 CCTTGTAAAATCTGTTCTTGCTG No data
Right 1169919642 20:10721106-10721128 TTGTATGAAGGAAAAGTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169919639 Original CRISPR CAGCAAGAACAGATTTTACA AGG (reversed) Intergenic
No off target data available for this crispr