ID: 1169923666

View in Genome Browser
Species Human (GRCh38)
Location 20:10760452-10760474
Sequence TCTTGTCACTAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169923660_1169923666 -1 Left 1169923660 20:10760430-10760452 CCCCAGTGTTAGTTAGCCTTGCT No data
Right 1169923666 20:10760452-10760474 TCTTGTCACTAGAAGGAGGAAGG No data
1169923662_1169923666 -3 Left 1169923662 20:10760432-10760454 CCAGTGTTAGTTAGCCTTGCTCT No data
Right 1169923666 20:10760452-10760474 TCTTGTCACTAGAAGGAGGAAGG No data
1169923661_1169923666 -2 Left 1169923661 20:10760431-10760453 CCCAGTGTTAGTTAGCCTTGCTC No data
Right 1169923666 20:10760452-10760474 TCTTGTCACTAGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169923666 Original CRISPR TCTTGTCACTAGAAGGAGGA AGG Intergenic
No off target data available for this crispr