ID: 1169930348

View in Genome Browser
Species Human (GRCh38)
Location 20:10826095-10826117
Sequence GGGTGACAACAGATGAAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169930348_1169930352 7 Left 1169930348 20:10826095-10826117 CCACGTTTCATCTGTTGTCACCC No data
Right 1169930352 20:10826125-10826147 ATACTAAGCAAGCAGCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169930348 Original CRISPR GGGTGACAACAGATGAAACG TGG (reversed) Intergenic
No off target data available for this crispr