ID: 1169930996

View in Genome Browser
Species Human (GRCh38)
Location 20:10832842-10832864
Sequence CTGTAGTTCTTGGGAGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169930988_1169930996 4 Left 1169930988 20:10832815-10832837 CCCTAATGTATCCTTTTCCCCTT No data
Right 1169930996 20:10832842-10832864 CTGTAGTTCTTGGGAGTACAAGG No data
1169930984_1169930996 30 Left 1169930984 20:10832789-10832811 CCCTTAGCTACCATTTGTCCTCT No data
Right 1169930996 20:10832842-10832864 CTGTAGTTCTTGGGAGTACAAGG No data
1169930986_1169930996 20 Left 1169930986 20:10832799-10832821 CCATTTGTCCTCTTTTCCCTAAT No data
Right 1169930996 20:10832842-10832864 CTGTAGTTCTTGGGAGTACAAGG No data
1169930990_1169930996 -7 Left 1169930990 20:10832826-10832848 CCTTTTCCCCTTTATGCTGTAGT No data
Right 1169930996 20:10832842-10832864 CTGTAGTTCTTGGGAGTACAAGG No data
1169930985_1169930996 29 Left 1169930985 20:10832790-10832812 CCTTAGCTACCATTTGTCCTCTT No data
Right 1169930996 20:10832842-10832864 CTGTAGTTCTTGGGAGTACAAGG No data
1169930989_1169930996 3 Left 1169930989 20:10832816-10832838 CCTAATGTATCCTTTTCCCCTTT No data
Right 1169930996 20:10832842-10832864 CTGTAGTTCTTGGGAGTACAAGG No data
1169930987_1169930996 12 Left 1169930987 20:10832807-10832829 CCTCTTTTCCCTAATGTATCCTT No data
Right 1169930996 20:10832842-10832864 CTGTAGTTCTTGGGAGTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169930996 Original CRISPR CTGTAGTTCTTGGGAGTACA AGG Intergenic
No off target data available for this crispr