ID: 1169931485

View in Genome Browser
Species Human (GRCh38)
Location 20:10837724-10837746
Sequence CACGATGCCCACAGTGCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169931475_1169931485 25 Left 1169931475 20:10837676-10837698 CCAAAGCAGATCTCTTCACTGAG No data
Right 1169931485 20:10837724-10837746 CACGATGCCCACAGTGCAAGGGG No data
1169931482_1169931485 1 Left 1169931482 20:10837700-10837722 CCAAAGTGAAGGGTTGGGGAAGT No data
Right 1169931485 20:10837724-10837746 CACGATGCCCACAGTGCAAGGGG No data
1169931481_1169931485 2 Left 1169931481 20:10837699-10837721 CCCAAAGTGAAGGGTTGGGGAAG No data
Right 1169931485 20:10837724-10837746 CACGATGCCCACAGTGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169931485 Original CRISPR CACGATGCCCACAGTGCAAG GGG Intergenic
No off target data available for this crispr