ID: 1169933318

View in Genome Browser
Species Human (GRCh38)
Location 20:10857175-10857197
Sequence CCTTCTCTTCAGGAGATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169933318_1169933322 23 Left 1169933318 20:10857175-10857197 CCTTCAATCTCCTGAAGAGAAGG No data
Right 1169933322 20:10857221-10857243 AACCAATGATGTTTAGTTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169933318 Original CRISPR CCTTCTCTTCAGGAGATTGA AGG (reversed) Intergenic
No off target data available for this crispr