ID: 1169935335

View in Genome Browser
Species Human (GRCh38)
Location 20:10877587-10877609
Sequence CCTTTGCCTCAAAGAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169935322_1169935335 30 Left 1169935322 20:10877534-10877556 CCCTGGGAGTGGCCAGCAGCCAA No data
Right 1169935335 20:10877587-10877609 CCTTTGCCTCAAAGAGAGGGAGG No data
1169935325_1169935335 18 Left 1169935325 20:10877546-10877568 CCAGCAGCCAAGGACTGACTGAT No data
Right 1169935335 20:10877587-10877609 CCTTTGCCTCAAAGAGAGGGAGG No data
1169935323_1169935335 29 Left 1169935323 20:10877535-10877557 CCTGGGAGTGGCCAGCAGCCAAG No data
Right 1169935335 20:10877587-10877609 CCTTTGCCTCAAAGAGAGGGAGG No data
1169935328_1169935335 11 Left 1169935328 20:10877553-10877575 CCAAGGACTGACTGATGCAGGGG No data
Right 1169935335 20:10877587-10877609 CCTTTGCCTCAAAGAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169935335 Original CRISPR CCTTTGCCTCAAAGAGAGGG AGG Intergenic
No off target data available for this crispr