ID: 1169935365

View in Genome Browser
Species Human (GRCh38)
Location 20:10877836-10877858
Sequence GGCAATTGGACTTTCTGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169935360_1169935365 7 Left 1169935360 20:10877806-10877828 CCATGAACAATTCCAGAGATTTT No data
Right 1169935365 20:10877836-10877858 GGCAATTGGACTTTCTGTCAGGG No data
1169935362_1169935365 -5 Left 1169935362 20:10877818-10877840 CCAGAGATTTTGAGACATGGCAA No data
Right 1169935365 20:10877836-10877858 GGCAATTGGACTTTCTGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169935365 Original CRISPR GGCAATTGGACTTTCTGTCA GGG Intergenic
No off target data available for this crispr