ID: 1169938965

View in Genome Browser
Species Human (GRCh38)
Location 20:10916507-10916529
Sequence GTCCCAGCCATGTTTTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169938965_1169938970 16 Left 1169938965 20:10916507-10916529 CCATGGGAAAACATGGCTGGGAC No data
Right 1169938970 20:10916546-10916568 CAGCCACAACTCCAGGACCCAGG No data
1169938965_1169938968 9 Left 1169938965 20:10916507-10916529 CCATGGGAAAACATGGCTGGGAC No data
Right 1169938968 20:10916539-10916561 CCTCATCCAGCCACAACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169938965 Original CRISPR GTCCCAGCCATGTTTTCCCA TGG (reversed) Intergenic
No off target data available for this crispr