ID: 1169938968

View in Genome Browser
Species Human (GRCh38)
Location 20:10916539-10916561
Sequence CCTCATCCAGCCACAACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169938965_1169938968 9 Left 1169938965 20:10916507-10916529 CCATGGGAAAACATGGCTGGGAC No data
Right 1169938968 20:10916539-10916561 CCTCATCCAGCCACAACTCCAGG No data
1169938961_1169938968 15 Left 1169938961 20:10916501-10916523 CCAAGCCCATGGGAAAACATGGC No data
Right 1169938968 20:10916539-10916561 CCTCATCCAGCCACAACTCCAGG No data
1169938964_1169938968 10 Left 1169938964 20:10916506-10916528 CCCATGGGAAAACATGGCTGGGA No data
Right 1169938968 20:10916539-10916561 CCTCATCCAGCCACAACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169938968 Original CRISPR CCTCATCCAGCCACAACTCC AGG Intergenic