ID: 1169938970

View in Genome Browser
Species Human (GRCh38)
Location 20:10916546-10916568
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169938964_1169938970 17 Left 1169938964 20:10916506-10916528 CCCATGGGAAAACATGGCTGGGA No data
Right 1169938970 20:10916546-10916568 CAGCCACAACTCCAGGACCCAGG No data
1169938965_1169938970 16 Left 1169938965 20:10916507-10916529 CCATGGGAAAACATGGCTGGGAC No data
Right 1169938970 20:10916546-10916568 CAGCCACAACTCCAGGACCCAGG No data
1169938961_1169938970 22 Left 1169938961 20:10916501-10916523 CCAAGCCCATGGGAAAACATGGC No data
Right 1169938970 20:10916546-10916568 CAGCCACAACTCCAGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169938970 Original CRISPR CAGCCACAACTCCAGGACCC AGG Intergenic