ID: 1169939326

View in Genome Browser
Species Human (GRCh38)
Location 20:10919847-10919869
Sequence GACCCTCATGGACCTCCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169939326_1169939334 29 Left 1169939326 20:10919847-10919869 CCTGGCGGAGGTCCATGAGGGTC No data
Right 1169939334 20:10919899-10919921 GTGTGTTGTCCAAGCACCTCGGG No data
1169939326_1169939331 6 Left 1169939326 20:10919847-10919869 CCTGGCGGAGGTCCATGAGGGTC No data
Right 1169939331 20:10919876-10919898 AAGGGCTTTTGTCGTGCTGAAGG No data
1169939326_1169939333 28 Left 1169939326 20:10919847-10919869 CCTGGCGGAGGTCCATGAGGGTC No data
Right 1169939333 20:10919898-10919920 GGTGTGTTGTCCAAGCACCTCGG No data
1169939326_1169939332 7 Left 1169939326 20:10919847-10919869 CCTGGCGGAGGTCCATGAGGGTC No data
Right 1169939332 20:10919877-10919899 AGGGCTTTTGTCGTGCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169939326 Original CRISPR GACCCTCATGGACCTCCGCC AGG (reversed) Intergenic
No off target data available for this crispr