ID: 1169939829

View in Genome Browser
Species Human (GRCh38)
Location 20:10925104-10925126
Sequence CTCTTCAAAGCTGAGCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169939829_1169939832 -7 Left 1169939829 20:10925104-10925126 CCACATGGCTCAGCTTTGAAGAG No data
Right 1169939832 20:10925120-10925142 TGAAGAGGGCCATGCTTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169939829 Original CRISPR CTCTTCAAAGCTGAGCCATG TGG (reversed) Intergenic
No off target data available for this crispr