ID: 1169947005

View in Genome Browser
Species Human (GRCh38)
Location 20:10999777-10999799
Sequence CAGAACTGGCAGAAGTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169947005_1169947011 18 Left 1169947005 20:10999777-10999799 CCTGTCCACTTCTGCCAGTTCTG No data
Right 1169947011 20:10999818-10999840 TACCCCACAGTGCAGGCTGAGGG No data
1169947005_1169947010 17 Left 1169947005 20:10999777-10999799 CCTGTCCACTTCTGCCAGTTCTG No data
Right 1169947010 20:10999817-10999839 TTACCCCACAGTGCAGGCTGAGG No data
1169947005_1169947012 19 Left 1169947005 20:10999777-10999799 CCTGTCCACTTCTGCCAGTTCTG No data
Right 1169947012 20:10999819-10999841 ACCCCACAGTGCAGGCTGAGGGG No data
1169947005_1169947009 11 Left 1169947005 20:10999777-10999799 CCTGTCCACTTCTGCCAGTTCTG No data
Right 1169947009 20:10999811-10999833 CTTTCTTTACCCCACAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169947005 Original CRISPR CAGAACTGGCAGAAGTGGAC AGG (reversed) Intergenic
No off target data available for this crispr