ID: 1169957950

View in Genome Browser
Species Human (GRCh38)
Location 20:11126795-11126817
Sequence AGCTTTAAGATATAAATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169957950_1169957959 24 Left 1169957950 20:11126795-11126817 CCCCCCATTTATATCTTAAAGCT No data
Right 1169957959 20:11126842-11126864 CACACTAAATTCCACCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169957950 Original CRISPR AGCTTTAAGATATAAATGGG GGG (reversed) Intergenic
No off target data available for this crispr