ID: 1169960677

View in Genome Browser
Species Human (GRCh38)
Location 20:11156391-11156413
Sequence TAAATCTCATGGTAGATTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169960674_1169960677 5 Left 1169960674 20:11156363-11156385 CCTTGTTACTGATGGTTTGTGTA No data
Right 1169960677 20:11156391-11156413 TAAATCTCATGGTAGATTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169960677 Original CRISPR TAAATCTCATGGTAGATTTA GGG Intergenic
No off target data available for this crispr