ID: 1169966473

View in Genome Browser
Species Human (GRCh38)
Location 20:11223391-11223413
Sequence ACCTTTTTCAATGATGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169966473_1169966484 26 Left 1169966473 20:11223391-11223413 CCCTACTCATCATTGAAAAAGGT No data
Right 1169966484 20:11223440-11223462 GATAAGGGGGCCCACCATTATGG No data
1169966473_1169966480 10 Left 1169966473 20:11223391-11223413 CCCTACTCATCATTGAAAAAGGT No data
Right 1169966480 20:11223424-11223446 AGGTAACAAAGCACATGATAAGG No data
1169966473_1169966483 13 Left 1169966473 20:11223391-11223413 CCCTACTCATCATTGAAAAAGGT No data
Right 1169966483 20:11223427-11223449 TAACAAAGCACATGATAAGGGGG No data
1169966473_1169966481 11 Left 1169966473 20:11223391-11223413 CCCTACTCATCATTGAAAAAGGT No data
Right 1169966481 20:11223425-11223447 GGTAACAAAGCACATGATAAGGG No data
1169966473_1169966476 -10 Left 1169966473 20:11223391-11223413 CCCTACTCATCATTGAAAAAGGT No data
Right 1169966476 20:11223404-11223426 TGAAAAAGGTGGTAACCCCTAGG No data
1169966473_1169966485 29 Left 1169966473 20:11223391-11223413 CCCTACTCATCATTGAAAAAGGT No data
Right 1169966485 20:11223443-11223465 AAGGGGGCCCACCATTATGGTGG No data
1169966473_1169966482 12 Left 1169966473 20:11223391-11223413 CCCTACTCATCATTGAAAAAGGT No data
Right 1169966482 20:11223426-11223448 GTAACAAAGCACATGATAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169966473 Original CRISPR ACCTTTTTCAATGATGAGTA GGG (reversed) Intergenic
No off target data available for this crispr