ID: 1169966476

View in Genome Browser
Species Human (GRCh38)
Location 20:11223404-11223426
Sequence TGAAAAAGGTGGTAACCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169966470_1169966476 0 Left 1169966470 20:11223381-11223403 CCCTTAGCATCCCTACTCATCAT No data
Right 1169966476 20:11223404-11223426 TGAAAAAGGTGGTAACCCCTAGG No data
1169966469_1169966476 13 Left 1169966469 20:11223368-11223390 CCATATCATTCAACCCTTAGCAT No data
Right 1169966476 20:11223404-11223426 TGAAAAAGGTGGTAACCCCTAGG No data
1169966473_1169966476 -10 Left 1169966473 20:11223391-11223413 CCCTACTCATCATTGAAAAAGGT No data
Right 1169966476 20:11223404-11223426 TGAAAAAGGTGGTAACCCCTAGG No data
1169966468_1169966476 14 Left 1169966468 20:11223367-11223389 CCCATATCATTCAACCCTTAGCA No data
Right 1169966476 20:11223404-11223426 TGAAAAAGGTGGTAACCCCTAGG No data
1169966471_1169966476 -1 Left 1169966471 20:11223382-11223404 CCTTAGCATCCCTACTCATCATT No data
Right 1169966476 20:11223404-11223426 TGAAAAAGGTGGTAACCCCTAGG No data
1169966467_1169966476 15 Left 1169966467 20:11223366-11223388 CCCCATATCATTCAACCCTTAGC No data
Right 1169966476 20:11223404-11223426 TGAAAAAGGTGGTAACCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169966476 Original CRISPR TGAAAAAGGTGGTAACCCCT AGG Intergenic
No off target data available for this crispr