ID: 1169966478

View in Genome Browser
Species Human (GRCh38)
Location 20:11223420-11223442
Sequence ATCATGTGCTTTGTTACCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169966478_1169966485 0 Left 1169966478 20:11223420-11223442 CCCTAGGTAACAAAGCACATGAT No data
Right 1169966485 20:11223443-11223465 AAGGGGGCCCACCATTATGGTGG No data
1169966478_1169966484 -3 Left 1169966478 20:11223420-11223442 CCCTAGGTAACAAAGCACATGAT No data
Right 1169966484 20:11223440-11223462 GATAAGGGGGCCCACCATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169966478 Original CRISPR ATCATGTGCTTTGTTACCTA GGG (reversed) Intergenic
No off target data available for this crispr