ID: 1169966483

View in Genome Browser
Species Human (GRCh38)
Location 20:11223427-11223449
Sequence TAACAAAGCACATGATAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169966471_1169966483 22 Left 1169966471 20:11223382-11223404 CCTTAGCATCCCTACTCATCATT No data
Right 1169966483 20:11223427-11223449 TAACAAAGCACATGATAAGGGGG No data
1169966470_1169966483 23 Left 1169966470 20:11223381-11223403 CCCTTAGCATCCCTACTCATCAT No data
Right 1169966483 20:11223427-11223449 TAACAAAGCACATGATAAGGGGG No data
1169966474_1169966483 12 Left 1169966474 20:11223392-11223414 CCTACTCATCATTGAAAAAGGTG No data
Right 1169966483 20:11223427-11223449 TAACAAAGCACATGATAAGGGGG No data
1169966473_1169966483 13 Left 1169966473 20:11223391-11223413 CCCTACTCATCATTGAAAAAGGT No data
Right 1169966483 20:11223427-11223449 TAACAAAGCACATGATAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169966483 Original CRISPR TAACAAAGCACATGATAAGG GGG Intergenic
No off target data available for this crispr