ID: 1169966484

View in Genome Browser
Species Human (GRCh38)
Location 20:11223440-11223462
Sequence GATAAGGGGGCCCACCATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169966473_1169966484 26 Left 1169966473 20:11223391-11223413 CCCTACTCATCATTGAAAAAGGT No data
Right 1169966484 20:11223440-11223462 GATAAGGGGGCCCACCATTATGG No data
1169966474_1169966484 25 Left 1169966474 20:11223392-11223414 CCTACTCATCATTGAAAAAGGTG No data
Right 1169966484 20:11223440-11223462 GATAAGGGGGCCCACCATTATGG No data
1169966478_1169966484 -3 Left 1169966478 20:11223420-11223442 CCCTAGGTAACAAAGCACATGAT No data
Right 1169966484 20:11223440-11223462 GATAAGGGGGCCCACCATTATGG No data
1169966479_1169966484 -4 Left 1169966479 20:11223421-11223443 CCTAGGTAACAAAGCACATGATA No data
Right 1169966484 20:11223440-11223462 GATAAGGGGGCCCACCATTATGG No data
1169966477_1169966484 -2 Left 1169966477 20:11223419-11223441 CCCCTAGGTAACAAAGCACATGA No data
Right 1169966484 20:11223440-11223462 GATAAGGGGGCCCACCATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169966484 Original CRISPR GATAAGGGGGCCCACCATTA TGG Intergenic
No off target data available for this crispr