ID: 1169966578 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:11224488-11224510 |
| Sequence | CTTTCTACCCATATGGAAAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1169966578_1169966585 | 16 | Left | 1169966578 | 20:11224488-11224510 | CCTTTTTCCATATGGGTAGAAAG | No data | ||
| Right | 1169966585 | 20:11224527-11224549 | TCACAGTCAGTGATAAGAGGAGG | No data | ||||
| 1169966578_1169966584 | 13 | Left | 1169966578 | 20:11224488-11224510 | CCTTTTTCCATATGGGTAGAAAG | No data | ||
| Right | 1169966584 | 20:11224524-11224546 | TACTCACAGTCAGTGATAAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1169966578 | Original CRISPR | CTTTCTACCCATATGGAAAA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||