ID: 1169966578

View in Genome Browser
Species Human (GRCh38)
Location 20:11224488-11224510
Sequence CTTTCTACCCATATGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169966578_1169966585 16 Left 1169966578 20:11224488-11224510 CCTTTTTCCATATGGGTAGAAAG No data
Right 1169966585 20:11224527-11224549 TCACAGTCAGTGATAAGAGGAGG No data
1169966578_1169966584 13 Left 1169966578 20:11224488-11224510 CCTTTTTCCATATGGGTAGAAAG No data
Right 1169966584 20:11224524-11224546 TACTCACAGTCAGTGATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169966578 Original CRISPR CTTTCTACCCATATGGAAAA AGG (reversed) Intergenic
No off target data available for this crispr