ID: 1169967135

View in Genome Browser
Species Human (GRCh38)
Location 20:11230198-11230220
Sequence CCTATGAAGTCCCAGGTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169967131_1169967135 9 Left 1169967131 20:11230166-11230188 CCATACCTAGTGCAGGACTTTCA No data
Right 1169967135 20:11230198-11230220 CCTATGAAGTCCCAGGTAAAAGG No data
1169967129_1169967135 22 Left 1169967129 20:11230153-11230175 CCTGAGGAGTTTTCCATACCTAG No data
Right 1169967135 20:11230198-11230220 CCTATGAAGTCCCAGGTAAAAGG No data
1169967132_1169967135 4 Left 1169967132 20:11230171-11230193 CCTAGTGCAGGACTTTCAGTGCT No data
Right 1169967135 20:11230198-11230220 CCTATGAAGTCCCAGGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169967135 Original CRISPR CCTATGAAGTCCCAGGTAAA AGG Intergenic
No off target data available for this crispr