ID: 1169975099

View in Genome Browser
Species Human (GRCh38)
Location 20:11316419-11316441
Sequence CTGAATCAGCATCACCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169975099_1169975107 26 Left 1169975099 20:11316419-11316441 CCACTCTGGTGATGCTGATTCAG No data
Right 1169975107 20:11316468-11316490 TGCATTTCTAACAAGCTCTCAGG 0: 27
1: 309
2: 986
3: 1883
4: 2496
1169975099_1169975103 -9 Left 1169975099 20:11316419-11316441 CCACTCTGGTGATGCTGATTCAG No data
Right 1169975103 20:11316433-11316455 CTGATTCAGCAGGTCTAGGGTGG 0: 7
1: 80
2: 365
3: 998
4: 1981

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169975099 Original CRISPR CTGAATCAGCATCACCAGAG TGG (reversed) Intergenic
No off target data available for this crispr