ID: 1169980750

View in Genome Browser
Species Human (GRCh38)
Location 20:11381018-11381040
Sequence TGGAGTCCTGTATTTCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169980750_1169980756 23 Left 1169980750 20:11381018-11381040 CCTCCAAGAAATACAGGACTCCA No data
Right 1169980756 20:11381064-11381086 ATTGGAGTACCAGAGGAGACAGG No data
1169980750_1169980755 16 Left 1169980750 20:11381018-11381040 CCTCCAAGAAATACAGGACTCCA No data
Right 1169980755 20:11381057-11381079 ACAACTGATTGGAGTACCAGAGG No data
1169980750_1169980757 24 Left 1169980750 20:11381018-11381040 CCTCCAAGAAATACAGGACTCCA No data
Right 1169980757 20:11381065-11381087 TTGGAGTACCAGAGGAGACAGGG No data
1169980750_1169980753 5 Left 1169980750 20:11381018-11381040 CCTCCAAGAAATACAGGACTCCA No data
Right 1169980753 20:11381046-11381068 AGACTGAACCTACAACTGATTGG 0: 15
1: 55
2: 144
3: 327
4: 1819

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169980750 Original CRISPR TGGAGTCCTGTATTTCTTGG AGG (reversed) Intergenic
No off target data available for this crispr