ID: 1169983449

View in Genome Browser
Species Human (GRCh38)
Location 20:11413387-11413409
Sequence TCTAGGGCTTTCAGAGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169983449_1169983457 28 Left 1169983449 20:11413387-11413409 CCCCTGCCTCTGAAAGCCCTAGA No data
Right 1169983457 20:11413438-11413460 TCTTTAGAATGCCAAAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169983449 Original CRISPR TCTAGGGCTTTCAGAGGCAG GGG (reversed) Intergenic
No off target data available for this crispr