ID: 1169983457

View in Genome Browser
Species Human (GRCh38)
Location 20:11413438-11413460
Sequence TCTTTAGAATGCCAAAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169983455_1169983457 -3 Left 1169983455 20:11413418-11413440 CCGTCTCTATCATTTTGCCTTCT No data
Right 1169983457 20:11413438-11413460 TCTTTAGAATGCCAAAGAAATGG No data
1169983451_1169983457 26 Left 1169983451 20:11413389-11413411 CCTGCCTCTGAAAGCCCTAGATC No data
Right 1169983457 20:11413438-11413460 TCTTTAGAATGCCAAAGAAATGG No data
1169983449_1169983457 28 Left 1169983449 20:11413387-11413409 CCCCTGCCTCTGAAAGCCCTAGA No data
Right 1169983457 20:11413438-11413460 TCTTTAGAATGCCAAAGAAATGG No data
1169983450_1169983457 27 Left 1169983450 20:11413388-11413410 CCCTGCCTCTGAAAGCCCTAGAT No data
Right 1169983457 20:11413438-11413460 TCTTTAGAATGCCAAAGAAATGG No data
1169983452_1169983457 22 Left 1169983452 20:11413393-11413415 CCTCTGAAAGCCCTAGATCTCTT No data
Right 1169983457 20:11413438-11413460 TCTTTAGAATGCCAAAGAAATGG No data
1169983453_1169983457 12 Left 1169983453 20:11413403-11413425 CCCTAGATCTCTTGACCGTCTCT No data
Right 1169983457 20:11413438-11413460 TCTTTAGAATGCCAAAGAAATGG No data
1169983448_1169983457 29 Left 1169983448 20:11413386-11413408 CCCCCTGCCTCTGAAAGCCCTAG No data
Right 1169983457 20:11413438-11413460 TCTTTAGAATGCCAAAGAAATGG No data
1169983454_1169983457 11 Left 1169983454 20:11413404-11413426 CCTAGATCTCTTGACCGTCTCTA No data
Right 1169983457 20:11413438-11413460 TCTTTAGAATGCCAAAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169983457 Original CRISPR TCTTTAGAATGCCAAAGAAA TGG Intergenic
No off target data available for this crispr