ID: 1169984189

View in Genome Browser
Species Human (GRCh38)
Location 20:11423418-11423440
Sequence GAGGGTAAGCAGAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169984189_1169984198 20 Left 1169984189 20:11423418-11423440 CCATCCTGCTTCTGCTTACCCTC No data
Right 1169984198 20:11423461-11423483 CAGTCCCAATGAAGTGAACTGGG No data
1169984189_1169984197 19 Left 1169984189 20:11423418-11423440 CCATCCTGCTTCTGCTTACCCTC No data
Right 1169984197 20:11423460-11423482 CCAGTCCCAATGAAGTGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169984189 Original CRISPR GAGGGTAAGCAGAAGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr