ID: 1169986200

View in Genome Browser
Species Human (GRCh38)
Location 20:11447611-11447633
Sequence GCACCCTGCTAAGCTGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169986194_1169986200 24 Left 1169986194 20:11447564-11447586 CCCAGAAAGGACCTTGACTGCAG No data
Right 1169986200 20:11447611-11447633 GCACCCTGCTAAGCTGCACCTGG No data
1169986196_1169986200 13 Left 1169986196 20:11447575-11447597 CCTTGACTGCAGCATCTTACAGA No data
Right 1169986200 20:11447611-11447633 GCACCCTGCTAAGCTGCACCTGG No data
1169986193_1169986200 25 Left 1169986193 20:11447563-11447585 CCCCAGAAAGGACCTTGACTGCA No data
Right 1169986200 20:11447611-11447633 GCACCCTGCTAAGCTGCACCTGG No data
1169986195_1169986200 23 Left 1169986195 20:11447565-11447587 CCAGAAAGGACCTTGACTGCAGC No data
Right 1169986200 20:11447611-11447633 GCACCCTGCTAAGCTGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169986200 Original CRISPR GCACCCTGCTAAGCTGCACC TGG Intergenic
No off target data available for this crispr