ID: 1169995033

View in Genome Browser
Species Human (GRCh38)
Location 20:11546817-11546839
Sequence GGGCCCGTATTTGCATCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169995031_1169995033 -3 Left 1169995031 20:11546797-11546819 CCTTGTAAGGAGTAAGAGAAGGG No data
Right 1169995033 20:11546817-11546839 GGGCCCGTATTTGCATCCTCAGG No data
1169995029_1169995033 6 Left 1169995029 20:11546788-11546810 CCTTTAGTTCCTTGTAAGGAGTA No data
Right 1169995033 20:11546817-11546839 GGGCCCGTATTTGCATCCTCAGG No data
1169995027_1169995033 26 Left 1169995027 20:11546768-11546790 CCATAGGGCTTTCAAATGTTCCT No data
Right 1169995033 20:11546817-11546839 GGGCCCGTATTTGCATCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169995033 Original CRISPR GGGCCCGTATTTGCATCCTC AGG Intergenic
No off target data available for this crispr