ID: 1170005986

View in Genome Browser
Species Human (GRCh38)
Location 20:11669587-11669609
Sequence AGTGTTCTGCAGAAGATGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170005986_1170005990 11 Left 1170005986 20:11669587-11669609 CCTAACATCTTCTGCAGAACACT No data
Right 1170005990 20:11669621-11669643 GCCTGGAGCAACCCAAACCCTGG No data
1170005986_1170005988 -6 Left 1170005986 20:11669587-11669609 CCTAACATCTTCTGCAGAACACT No data
Right 1170005988 20:11669604-11669626 AACACTATTGGTCCTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170005986 Original CRISPR AGTGTTCTGCAGAAGATGTT AGG (reversed) Intergenic
No off target data available for this crispr