ID: 1170007594

View in Genome Browser
Species Human (GRCh38)
Location 20:11686253-11686275
Sequence GGGTTGGAGGATGTAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170007594_1170007600 25 Left 1170007594 20:11686253-11686275 CCTGTGTTTACATCCTCCAACCC 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1170007600 20:11686301-11686323 CTGACCAAGACTCACTGTTTTGG 0: 1
1: 0
2: 0
3: 13
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170007594 Original CRISPR GGGTTGGAGGATGTAAACAC AGG (reversed) Intergenic
904792057 1:33030091-33030113 GTGGTGCAGGACGTAAACACAGG - Intronic
907690640 1:56661355-56661377 GGGGTGGAGGTTGGAAACAAGGG - Intronic
907725079 1:57012587-57012609 GGGTCAGAGGATATAAAGACTGG + Intronic
908078627 1:60548989-60549011 GAGTTTGAGGATGTATACAAAGG - Intergenic
909007483 1:70294254-70294276 GGTCTGGAGGATATAAAAACTGG + Intronic
911099945 1:94087612-94087634 GGGATGAAGGAGGGAAACACAGG + Intronic
911570219 1:99510715-99510737 GGGTTGGAGCATGGAAATAAGGG - Intergenic
917192166 1:172429607-172429629 GGCTTGGAGGATGTAAATGATGG + Intronic
917468201 1:175303013-175303035 GGGTTGGAGGAAGGGAATACTGG + Intergenic
919820772 1:201470503-201470525 GGGCAGGAGGATGGCAACACAGG - Intergenic
919901353 1:202046371-202046393 GGAAGGGAGGATGTAAACAGAGG - Intergenic
921330130 1:214027198-214027220 GGGTTGGGGGAAGCAAACCCAGG - Intronic
1062915017 10:1238054-1238076 GGGATGCAGGGAGTAAACACCGG - Intronic
1062915055 10:1238171-1238193 GGGATGCAGGGAGTAAACACCGG - Intronic
1062915114 10:1238360-1238382 GGGATGCAGGGAGTAAACACCGG - Intronic
1062915220 10:1238694-1238716 GGGATGCAGGGAGTAAACACCGG - Intronic
1062915279 10:1238883-1238905 GGGATGCAGGGAGTAAACACCGG - Intronic
1062974592 10:1674216-1674238 GGGTTGGAGGCTTTAAAAAATGG - Intronic
1063896502 10:10687798-10687820 GGGTAGGAGAGTGTAAACACTGG - Intergenic
1066058209 10:31700549-31700571 GGGTGGGAGGAGGCAAAAACAGG + Intergenic
1071501236 10:86205848-86205870 GGGTTGGGGGTTGGGAACACTGG - Intronic
1072216344 10:93290478-93290500 GTGTTGGATGAAGAAAACACAGG + Intergenic
1073596764 10:104808299-104808321 GGGGCTGAGGATGTAAAGACAGG + Intronic
1074773263 10:116747107-116747129 GGTGGGGAGGATGTATACACTGG - Intergenic
1075760092 10:124849094-124849116 GGCTTGGAGAATGTCAGCACAGG + Intergenic
1080314566 11:30935021-30935043 GGGTTAGGGGCTGTCAACACAGG - Intronic
1084188499 11:67488161-67488183 GGGTTGGAGGACCCAAACATGGG - Intronic
1085987851 11:81807344-81807366 GGGTTGGAGCATGGAAATAAGGG - Intergenic
1086080279 11:82896772-82896794 AGGTTGGAGGCTGGAAACCCAGG - Intronic
1093467050 12:19460202-19460224 GGGTGGGGGGATGTTAAGACAGG - Intronic
1096522042 12:52189864-52189886 GGATGGGAGGATATAAGCACAGG - Intronic
1096544276 12:52327045-52327067 GGGTGGGAGGATGAGAACCCTGG + Intergenic
1102538765 12:113602712-113602734 ACCTTGGAGGATGTAAATACAGG + Intergenic
1106899473 13:34340194-34340216 GAATTGAAGGAGGTAAACACAGG - Intergenic
1107045489 13:35988122-35988144 GGGTTGGAGGGAGGAAACAGTGG - Intronic
1107220461 13:37973749-37973771 GGGTTGGGGCATGGAAATACGGG + Intergenic
1109904466 13:68820538-68820560 GGGAGAGAGGATGTAAGCACTGG + Intergenic
1111399081 13:87708593-87708615 GGGGTGAAGGAGGTAAAAACTGG + Intergenic
1113709077 13:112452385-112452407 GGGTGGGAGGATGTGGCCACAGG + Intergenic
1119209742 14:72822577-72822599 GGGTCTGAGGATGTGAAAACAGG + Intronic
1120757408 14:88257188-88257210 GGGTTGGAGGAAGGAGAAACGGG - Intronic
1122778427 14:104133365-104133387 GGGAAGGAGGCTGTAAACACAGG + Intergenic
1127830132 15:62743329-62743351 GGGTTTGAGACTGTTAACACAGG - Intronic
1132050787 15:98606214-98606236 GGGTTGGGAGATGAAAACACAGG + Intergenic
1132221568 15:100109129-100109151 AGGTTGGAGGACGTTGACACGGG + Intronic
1138443964 16:57051719-57051741 GGGTTGGAGGGGGTAAAGGCGGG - Intronic
1140455274 16:75101614-75101636 GGGTTGGTGGATGGATAAACGGG - Intronic
1140942144 16:79732121-79732143 GGTTTGGAGGATACAAGCACAGG - Intergenic
1144748490 17:17632075-17632097 GGGCTGGAGGAAGTACATACAGG + Intergenic
1146505266 17:33399417-33399439 GGGAAGGGGGATGTAATCACTGG - Intronic
1147895296 17:43746767-43746789 GGGTTTGATGGTGAAAACACTGG + Intergenic
1149363163 17:55914670-55914692 TGGAGGGAGGATGTAGACACTGG - Intergenic
1149416249 17:56462796-56462818 GGATTGGAGGCTGTCAAGACTGG - Intronic
1150313786 17:64151462-64151484 GGGGTGTAGGATGAAAAAACAGG - Intronic
1151424457 17:74021769-74021791 GGCTTGGAGAATGTTACCACTGG + Intergenic
1153480044 18:5538533-5538555 CTATTTGAGGATGTAAACACAGG + Intronic
1155094816 18:22545367-22545389 GGGCTGAAGAATGAAAACACTGG - Intergenic
1155844798 18:30692748-30692770 GCTTTGGAGAATGTAAGCACAGG - Intergenic
1159613459 18:70551880-70551902 GGGTTAGAGGATGAAAATTCTGG + Intergenic
1159904035 18:74074617-74074639 GGCTTGCAGGGTGAAAACACTGG - Intronic
1160405711 18:78645137-78645159 GGGGTGCAGGATGGAAACCCTGG - Intergenic
1161335145 19:3708912-3708934 GGGCTGCAGGAGGTAAACCCAGG - Intronic
1162923086 19:13915000-13915022 GGGTTTGAGAAAGCAAACACTGG + Intronic
1166324529 19:42041189-42041211 GGGTTGGATGCTGTAAATTCTGG + Intronic
1166890274 19:45987545-45987567 AGGTTGGAGGAGGGAACCACAGG - Intergenic
925330595 2:3055383-3055405 GGGATGGAGGATGTGCACACAGG - Intergenic
926103357 2:10134848-10134870 GTGTTTGAGGAGGTAAAGACTGG + Intergenic
926329930 2:11815881-11815903 GAGTTGGAGGAAGAAAACACTGG + Intronic
926822153 2:16864073-16864095 TTGCTGGAGGATGTAAAAACTGG + Intergenic
928061246 2:28115694-28115716 GGGTTGGGGGATGTAGACCGGGG + Intronic
930731802 2:54734971-54734993 TGGCTGGAGGATGTTAAGACAGG - Intronic
930817550 2:55614640-55614662 GGGATGGAGAATGTAAACAACGG + Intronic
931110730 2:59108540-59108562 GGGGTGAAGGATGCAGACACAGG - Intergenic
931190943 2:59999657-59999679 GGGTTGGACTTTGTAAGCACAGG + Intergenic
931494642 2:62789664-62789686 GGGTTGGAAGATGTATGCATTGG - Intronic
943784736 2:191864852-191864874 AGGTAGGAGGTTGTAATCACAGG - Intergenic
945080649 2:206084838-206084860 GGGAAGGAGGAGGTAAACTCAGG - Intronic
946881657 2:224182755-224182777 GGGTTGGGGGATGAGACCACAGG + Intergenic
1169423110 20:5475324-5475346 GGGTTGGGGGAAGTAAATAATGG + Intergenic
1170007594 20:11686253-11686275 GGGTTGGAGGATGTAAACACAGG - Intergenic
1170287692 20:14728987-14729009 TAATTGGAAGATGTAAACACAGG - Intronic
1171196412 20:23203055-23203077 GGGATGGAGGATGTACACGCAGG - Intergenic
1173003827 20:39124502-39124524 GGGTTGGGGGATGTTTACAGTGG - Intergenic
1175507696 20:59497618-59497640 TGGCTGGAGGATGTGGACACAGG - Intergenic
1175893506 20:62325656-62325678 GGGCAGGAGGAGGTACACACAGG + Intronic
1179784290 21:43720678-43720700 GGGTTGGGGGAGGTCACCACAGG + Intronic
1181402839 22:22661712-22661734 GGGCTGAAGGAAGTAAAGACTGG - Intergenic
1182551651 22:31104036-31104058 GGGTTGGAGGAAGCAGACCCAGG + Intronic
1183309965 22:37104094-37104116 GGGCTGGAGGAAGAAAACATGGG - Intronic
1184959052 22:47915540-47915562 GGGATGGAGGAAGTAAGGACAGG + Intergenic
949546468 3:5077141-5077163 GTTTTGGAGGATGGAATCACTGG + Intergenic
950113346 3:10434712-10434734 GGGTTGGAGGCTGTCAGCCCTGG - Intronic
950897121 3:16462989-16463011 GGGTTCGGGGAAGGAAACACAGG + Intronic
951954515 3:28240283-28240305 GAGATGGAGTATGAAAACACAGG - Intergenic
953492460 3:43363211-43363233 GGGTTTGAGGCTGGGAACACGGG + Intronic
955067420 3:55545239-55545261 GGGCTGGAGGATGTTGACGCAGG - Intronic
957887848 3:86313627-86313649 GGGTTGGAGGAAATTCACACTGG - Intergenic
958126596 3:89364327-89364349 GGCTTGGAGTAGGTAAATACTGG - Intronic
959557100 3:107733211-107733233 GGCCATGAGGATGTAAACACAGG + Intronic
960878879 3:122325054-122325076 GGGTTGGAGGATGAACAAATGGG - Intergenic
962476287 3:135758250-135758272 GGGTGGGAGAATGTTGACACAGG - Intergenic
964200258 3:154111235-154111257 GGGTTGGAGGAGGTAGATCCTGG - Intergenic
968067938 3:195769157-195769179 GGGTGGGTGGAAGAAAACACAGG + Intronic
968844380 4:3031796-3031818 GGGATGGAGGATGAAGTCACTGG + Intronic
970050900 4:11914017-11914039 GTGTTGGAGGATTTAAGCAAAGG - Intergenic
971106135 4:23525689-23525711 GAGCTGAAGGATGAAAACACTGG + Intergenic
972281188 4:37603443-37603465 GGGTCGGAGGATCTAAGAACTGG + Intronic
977241810 4:94580442-94580464 GGGTTTGGGGATGTTTACACTGG - Intronic
978134997 4:105246792-105246814 GGTTTGGAGCATGTGGACACAGG - Intronic
979095729 4:116547761-116547783 GGATTGGATAATGTAAACAGTGG + Intergenic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982450634 4:155548458-155548480 GGGTTGGAGGGAGTGACCACTGG + Intergenic
984096567 4:175442304-175442326 GTCTTGGAGGATGCACACACAGG - Intergenic
985680611 5:1253868-1253890 GGGTTGGAGGATGCCACCTCTGG - Intronic
989548983 5:42710020-42710042 GGCTTTGAGGATGAAAACATAGG + Intronic
990013466 5:51028022-51028044 GGATTTGAGGATGAAAACCCAGG - Intergenic
991515106 5:67426733-67426755 GGGTTGGAGAACATAAACAATGG - Intergenic
993041989 5:82824850-82824872 TGGTGGGCTGATGTAAACACTGG - Intergenic
995834908 5:116390339-116390361 GGGTTCTAGACTGTAAACACTGG + Intronic
998005728 5:138655643-138655665 GGGTTGGAGGGTTTAGACATCGG + Intronic
998465773 5:142342584-142342606 GGCTGGGAGGAGGTGAACACAGG - Intergenic
999784195 5:154876603-154876625 GGATTGGTGGAAGTAAAAACTGG + Exonic
1002645473 5:180650857-180650879 GGCCTGGAGAATGGAAACACAGG - Intergenic
1003302206 6:4893728-4893750 GGGTTGGAGGAGACACACACAGG - Intronic
1003430330 6:6032346-6032368 GGGTTGGAGCATGGAAATAAGGG + Intergenic
1007625607 6:43244540-43244562 GGGTTGGATGATACAAACATGGG - Intronic
1007700931 6:43766206-43766228 GGGGTGGAGGATGTGAACAGGGG + Intergenic
1009944588 6:70328842-70328864 GGGTTGGAGGAGGGATAAACTGG + Intergenic
1010042783 6:71406334-71406356 GGATTGGAGGATGTAGAGCCTGG - Intergenic
1010993370 6:82504957-82504979 GAATTGGAGAATGTAAAAACTGG - Intergenic
1015324682 6:131911132-131911154 GGTTTTGATGATGTAATCACTGG - Intergenic
1015571818 6:134629403-134629425 GCGTTGGAGAAAGTAAAAACAGG + Intergenic
1018037890 6:159897244-159897266 AGGTTGGAGGATGAAGTCACAGG + Intergenic
1018188414 6:161287794-161287816 GGGTCTGAGGATGGAAACCCGGG + Intergenic
1019908613 7:4083716-4083738 GGGATGGAGGAAGTAAAGAAGGG - Intronic
1026683563 7:72489078-72489100 GGGTTGGCGGATGGACTCACAGG - Intergenic
1026774078 7:73220473-73220495 GGCTTGCAGGGTGTAAACATGGG - Intergenic
1027014935 7:74773859-74773881 GGCTTGCAGGGTGTAAACATGGG - Intergenic
1027073096 7:75172094-75172116 GGCTTGCAGGGTGTAAACATGGG + Intergenic
1028160713 7:87481854-87481876 GGGTTGAAGGAAGTAAAGGCAGG - Intergenic
1030066727 7:105665228-105665250 GGATTGGAGGCTGGAGACACTGG + Exonic
1031835238 7:126673382-126673404 GATTTAGAGGATGTATACACAGG + Intronic
1033669912 7:143481825-143481847 GGGGAGGAGGATGTCAACAAAGG + Intergenic
1036788828 8:11704580-11704602 GGGTTGGAGAATGTGCACACGGG - Intronic
1039553432 8:38459747-38459769 GGGTGGGAGGAAGTAAATAAGGG + Intronic
1043453449 8:80391682-80391704 TGGTTGGAGGCTGTGACCACTGG + Intergenic
1044352871 8:91186822-91186844 GGGATGGAGGATGGAAAGAGAGG + Intronic
1047088444 8:121545832-121545854 GGGTTGGAGACTGTAGTCACTGG - Intergenic
1047370881 8:124254829-124254851 GGGTTGGGTGATGAAAATACTGG - Intergenic
1049420080 8:142512571-142512593 GTGTTGGAGTCTGGAAACACAGG + Intronic
1052704441 9:31978027-31978049 GGGTTGTAGGCTGGAAACTCAGG - Intergenic
1056736151 9:89211038-89211060 GGGTTGGAGGTTAAAAGCACTGG - Intergenic
1059343625 9:113613547-113613569 GGGCTGGAGGATTTTAAAACTGG + Intergenic
1060396200 9:123318710-123318732 GAGTTGGAGGATGAAGACTCTGG + Intergenic
1060766414 9:126297561-126297583 GAGTTGGATGTTGGAAACACAGG + Intergenic
1185671012 X:1810267-1810289 GGGGTTGAGGATTTCAACACAGG - Intergenic
1188480052 X:30628245-30628267 GGCTTTGGGGATGTAAATACAGG - Intergenic
1192888604 X:75363799-75363821 GGGTTGCATGATGAAAACAGAGG - Intergenic
1193195342 X:78625101-78625123 GATTTGGAGGCAGTAAACACAGG - Intergenic
1198132529 X:133711569-133711591 GGATTGGAGGAGGTCAAAACTGG - Intronic