ID: 1170012680

View in Genome Browser
Species Human (GRCh38)
Location 20:11743577-11743599
Sequence CACATTATGATTTCTTTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170012680_1170012681 11 Left 1170012680 20:11743577-11743599 CCATGTAAAGAAATCATAATGTG No data
Right 1170012681 20:11743611-11743633 AAGAGAGAAAACCCTTCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170012680 Original CRISPR CACATTATGATTTCTTTACA TGG (reversed) Intergenic
No off target data available for this crispr