ID: 1170016640

View in Genome Browser
Species Human (GRCh38)
Location 20:11789306-11789328
Sequence TTCCCAAAATTTGTGAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170016640_1170016645 9 Left 1170016640 20:11789306-11789328 CCCCTTTTCACAAATTTTGGGAA No data
Right 1170016645 20:11789338-11789360 CACCCTTATCAACTGTACTTTGG No data
1170016640_1170016648 22 Left 1170016640 20:11789306-11789328 CCCCTTTTCACAAATTTTGGGAA No data
Right 1170016648 20:11789351-11789373 TGTACTTTGGCCATGACTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170016640 Original CRISPR TTCCCAAAATTTGTGAAAAG GGG (reversed) Intergenic
No off target data available for this crispr