ID: 1170016643

View in Genome Browser
Species Human (GRCh38)
Location 20:11789314-11789336
Sequence CACAAATTTTGGGAATTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170016636_1170016643 -7 Left 1170016636 20:11789298-11789320 CCCTCAGTCCCCTTTTCACAAAT No data
Right 1170016643 20:11789314-11789336 CACAAATTTTGGGAATTTACTGG No data
1170016637_1170016643 -8 Left 1170016637 20:11789299-11789321 CCTCAGTCCCCTTTTCACAAATT No data
Right 1170016643 20:11789314-11789336 CACAAATTTTGGGAATTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170016643 Original CRISPR CACAAATTTTGGGAATTTAC TGG Intergenic
No off target data available for this crispr