ID: 1170016644

View in Genome Browser
Species Human (GRCh38)
Location 20:11789337-11789359
Sequence CAAAGTACAGTTGATAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170016644_1170016648 -9 Left 1170016644 20:11789337-11789359 CCACCCTTATCAACTGTACTTTG No data
Right 1170016648 20:11789351-11789373 TGTACTTTGGCCATGACTTAAGG No data
1170016644_1170016649 0 Left 1170016644 20:11789337-11789359 CCACCCTTATCAACTGTACTTTG No data
Right 1170016649 20:11789360-11789382 GCCATGACTTAAGGTGTCCTTGG No data
1170016644_1170016651 13 Left 1170016644 20:11789337-11789359 CCACCCTTATCAACTGTACTTTG No data
Right 1170016651 20:11789373-11789395 GTGTCCTTGGAATAACCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170016644 Original CRISPR CAAAGTACAGTTGATAAGGG TGG (reversed) Intergenic
No off target data available for this crispr