ID: 1170016645

View in Genome Browser
Species Human (GRCh38)
Location 20:11789338-11789360
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170016640_1170016645 9 Left 1170016640 20:11789306-11789328 CCCCTTTTCACAAATTTTGGGAA No data
Right 1170016645 20:11789338-11789360 CACCCTTATCAACTGTACTTTGG No data
1170016637_1170016645 16 Left 1170016637 20:11789299-11789321 CCTCAGTCCCCTTTTCACAAATT No data
Right 1170016645 20:11789338-11789360 CACCCTTATCAACTGTACTTTGG No data
1170016642_1170016645 7 Left 1170016642 20:11789308-11789330 CCTTTTCACAAATTTTGGGAATT No data
Right 1170016645 20:11789338-11789360 CACCCTTATCAACTGTACTTTGG No data
1170016636_1170016645 17 Left 1170016636 20:11789298-11789320 CCCTCAGTCCCCTTTTCACAAAT No data
Right 1170016645 20:11789338-11789360 CACCCTTATCAACTGTACTTTGG No data
1170016641_1170016645 8 Left 1170016641 20:11789307-11789329 CCCTTTTCACAAATTTTGGGAAT No data
Right 1170016645 20:11789338-11789360 CACCCTTATCAACTGTACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170016645 Original CRISPR CACCCTTATCAACTGTACTT TGG Intergenic