ID: 1170016646 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:11789340-11789362 |
| Sequence | GGCCAAAGTACAGTTGATAA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1170016646_1170016651 | 10 | Left | 1170016646 | 20:11789340-11789362 | CCCTTATCAACTGTACTTTGGCC | No data | ||
| Right | 1170016651 | 20:11789373-11789395 | GTGTCCTTGGAATAACCTGTTGG | No data | ||||
| 1170016646_1170016649 | -3 | Left | 1170016646 | 20:11789340-11789362 | CCCTTATCAACTGTACTTTGGCC | No data | ||
| Right | 1170016649 | 20:11789360-11789382 | GCCATGACTTAAGGTGTCCTTGG | No data | ||||
| 1170016646_1170016654 | 29 | Left | 1170016646 | 20:11789340-11789362 | CCCTTATCAACTGTACTTTGGCC | No data | ||
| Right | 1170016654 | 20:11789392-11789414 | TTGGCTCCCCATTAACCTTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1170016646 | Original CRISPR | GGCCAAAGTACAGTTGATAA GGG (reversed) | Intergenic | ||