ID: 1170016649

View in Genome Browser
Species Human (GRCh38)
Location 20:11789360-11789382
Sequence GCCATGACTTAAGGTGTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170016647_1170016649 -4 Left 1170016647 20:11789341-11789363 CCTTATCAACTGTACTTTGGCCA No data
Right 1170016649 20:11789360-11789382 GCCATGACTTAAGGTGTCCTTGG No data
1170016641_1170016649 30 Left 1170016641 20:11789307-11789329 CCCTTTTCACAAATTTTGGGAAT No data
Right 1170016649 20:11789360-11789382 GCCATGACTTAAGGTGTCCTTGG No data
1170016642_1170016649 29 Left 1170016642 20:11789308-11789330 CCTTTTCACAAATTTTGGGAATT No data
Right 1170016649 20:11789360-11789382 GCCATGACTTAAGGTGTCCTTGG No data
1170016644_1170016649 0 Left 1170016644 20:11789337-11789359 CCACCCTTATCAACTGTACTTTG No data
Right 1170016649 20:11789360-11789382 GCCATGACTTAAGGTGTCCTTGG No data
1170016646_1170016649 -3 Left 1170016646 20:11789340-11789362 CCCTTATCAACTGTACTTTGGCC No data
Right 1170016649 20:11789360-11789382 GCCATGACTTAAGGTGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170016649 Original CRISPR GCCATGACTTAAGGTGTCCT TGG Intergenic