ID: 1170016748

View in Genome Browser
Species Human (GRCh38)
Location 20:11790320-11790342
Sequence TAAACCACCTAAAACCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170016744_1170016748 -1 Left 1170016744 20:11790298-11790320 CCCACTTGTCTCCTGACTATTCT No data
Right 1170016748 20:11790320-11790342 TAAACCACCTAAAACCTGCTGGG No data
1170016742_1170016748 23 Left 1170016742 20:11790274-11790296 CCACAGAGACCACATGGAAGGCA No data
Right 1170016748 20:11790320-11790342 TAAACCACCTAAAACCTGCTGGG No data
1170016745_1170016748 -2 Left 1170016745 20:11790299-11790321 CCACTTGTCTCCTGACTATTCTA No data
Right 1170016748 20:11790320-11790342 TAAACCACCTAAAACCTGCTGGG No data
1170016743_1170016748 14 Left 1170016743 20:11790283-11790305 CCACATGGAAGGCAGCCCACTTG No data
Right 1170016748 20:11790320-11790342 TAAACCACCTAAAACCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170016748 Original CRISPR TAAACCACCTAAAACCTGCT GGG Intergenic
No off target data available for this crispr