ID: 1170020410

View in Genome Browser
Species Human (GRCh38)
Location 20:11831076-11831098
Sequence TCACCTATTTGGGGATGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170020410_1170020416 7 Left 1170020410 20:11831076-11831098 CCAGTCCATCCCCAAATAGGTGA No data
Right 1170020416 20:11831106-11831128 AAGCTGAGCTCAGCCAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170020410 Original CRISPR TCACCTATTTGGGGATGGAC TGG (reversed) Intergenic
No off target data available for this crispr